Description :
From Genome Similarity Track
Location :
Scaffold_13:339049- 341263
Transcript NameFunction/comments
Aphas_H257_05747putative polyprotein

Sequence
2214 bases(100 bases per row)
AACCCCTACTACGACTTGGTTCGTGAGTTCCAAGATAGCTTCCCGGACAGTGTTCCGAAATGCCTCCCCAAAGACAAAGGGGTAAGGCACAACATTGACT
TGGTGCCCGGCACCAAGTGGTGCGTCACTCGACAGTGGCGACTACCACGCGACCAAGTCGCATATATTGACGAGTTCTTGCAGCACGCAAGCGAGCCTGT
CACGTGTGGGAGAGCAAGTCCCCGCACTCTTGTCCCACCTTGTGTGTTAAGAAAGGCAGCGGGAAATGGCGCATTATTCACGCCTACAACAAGTTGAACT
CTGCCACGATTCCGGCGCAGACGCCGATCCCGTGGAAGGATGTCATCATTAACTCCATGGGACAGTCCACGATCTTCAGCACCATCGACCTTCGCGATGG
GTTCTACAGCACCTGTACCAGGTCCTGATGAAGATCAGGGACATCGAACAGACAGCCGTCTCTACACCCAGTGGAATACTCTGGAAATGGCTGGTGATGC
CCCAGGGACTCAAGAACGCCCCTGCCTTCAATCGCGTCGTCACGGAGAAACTCCGTCAGTTTCGCGAATTTGCTCCGTCGTATTTCGACGACGTCTACAT
CACAGTCGCGCCAGTTCGTCGCAATCCGACGCGGATGTCCACCGGTCACACCTACGTTTGGTGCTTGAGACCCTGCGAGACACCGGCCTATATGCGAACC
CCTCGAAGTGCTCCTTCGGGGTACCCGAGATTCCTGTCCTCGGTGACTTCGTTGGTATCAACGGCTGCCAAGGTGGCCGTAATCAAAGCTTGGCCATCGC
CAAGTTCAGTCCCCGAACTGTGCAGTTGGACTCGCCACCTATCTGCACAAGTACTCAACGAATTTCGCCGACCTGGCATGCATGATGACACGCTTACTTG
GCAAGGACGTTCCTTGGGCATGGTCCCAAGAGTGCCAAGTGGCCTTCGAGGCCGTCAAGGCGAGCCTCACCATGGCCTACCAGACTATTCCAGACCCTTC
GTCGTGGTCTACAACGCATCCATTCGCGCCATCGGTTGCTGCCTGACGCAGTGCGACGATTCGGGCCGGGATCGCCCGGTATCGTTCCAGTCCTACCAGC
TCCACAAGTCCGAGAAGAACTATCCTATTCATGACTTGGGGCTTCTGGCGATGTACTACGCCTTCAAGAAGTTTCGTATCTACCTCCTGGGTTTGGAGGA
ATTCGTGGCCTTCCCTGACCACGAATCTCTACAGCGCTGGCTCTCCTTCTTTGTGGAATTCAACATGAAGGTTGAATACAACCCTACCCGCGCGACAACG
TTGTCGCGGATGTTTTGTCCCGACTCCCGTCGGTATACAAAAATGGAGCTCACCTTCATCTCCACGGTCCACTCGGATGGCTCGCATCCGAGCAGCTTAC
ACAACTGACCCCGCTTTGGATCCGATCATCGCCCACCTACGTGATGGCGTAGCGATATCTTCTGGTATCCCCCAACTCGACCGCTATTTGGTCCGTGGCG
GTCTGTTGATGTATTCCACTAACACGACTGATTGCTCTCAGGTCGCAGTTCCCTGCGACCATTCTCTACGGAAGGACATCCTGCACGAGCTCCACGATGC
CCCAAGCGGGGGTCACTTCGGTCGCGACCGAATGTACACTACCGTCGCTCGACTCTTTTGGTTGCCGCGTTTGTATAAACACGTTGCTCGCTAAGTCGCC
TCCTCCGACGCCTGCCAATCAATCAAGGCCGTCGCGTCCACTCAAGCTCCACTCGCGAACTCTGGGAATCCGTCAGTTTGGACTTCATCTTTGGCCTTCC
CCGCGACCAATGCGGCAACACTGGCATTTGGGTATGCGTCGAGCGGGGGTCGAAATACCTTGTGGCAGTCGCCGTCAGGGCGAGCATCACAGTTGAGCGC
TGCGACGCGCTCTTCTTGGACAACATGTATTGTCGCTTTGGCCTCCCTTCTTCCATCATCTCCGATCGAAATCCACGTTTCACTTCTGCTTTCTGGAAGT
TCTTGTTTGCCCGCATTGGCACTCGCCTCAGCATGTCCTCGGCCGACCATCCCGAGACTATCGGCCAAACCGAACGCGCTATCCGCGTTATCGAAGATGT
TCTCCGCAGTTATGCTGCGTCGAAACCTCGCGCATGGAGTTCCCTACTCCACCAAGTGGCCCCCACGGGATTTTCCCCGTTTTATGCAAACCATCTGCGT
CACCCCCGTCTTCC