Description :
From Genome Similarity Track
Location :
Scaffold_13:339019- 341163
Transcript NameFunction/comments
Aphas_H257_05747putative polyprotein

Sequence
2144 bases(100 bases per row)
TCCTTATCGGTATGGAAGGATTTGGAAACGAACCCCTACTACGACTTGGTTCGTGAGTTCCAAGATAGCTTCCCGGACAGTGTTCCGAAATGCCTCCCCA
AAGACAAAGGGGTAAGGCACAACATTGACTTGGTGCCCGGCACCAAGTGGTGCGTCACTCGACAGTGGCGACTACCACGCGACCAAGTCGCATATATTGA
CGAGTTCTTGCAGCACGCAAGCGAGCCTGTCACGTGTGGGAGAGCAAGTCCCCGCACTCTTGTCCCACCTTGTGTGTTAAGAAAGGCAGCGGGAAATGGC
GCATTATTCACGCCTACAACAAGTTGAACTCTGCCACGATTCCGGCGCAGACGCCGATCCCGTGGAAGGATGTCATCATTAACTCCATGGGACAGTCCAC
GATCTTCAGCACCATCGACCTTCGCGATGGGTTCTACAGCACCTGTACCAGGTCCTGATGAAGATCAGGGACATCGAACAGACAGCCGTCTCTACACCCA
GTGGAATACTCTGGAAATGGCTGGTGATGCCCCAGGGACTCAAGAACGCCCCTGCCTTCAATCGCGTCGTCACGGAGAAACTCCGTCAGTTTCGCGAATT
TGCTCCGTCGTATTTCGACGACGTCTACATCACAGTCGCGCCAGTTCGTCGCAATCCGACGCGGATGTCCACCGGTCACACCTACGTTTGGTGCTTGAGA
CCCTGCGAGACACCGGCCTATATGCGAACCCCTCGAAGTGCTCCTTCGGGGTACCCGAGATTCCTGTCCTCGGTGACTTCGTTGGTATCAACGGCTGCCA
AGGTGGCCGTAATCAAAGCTTGGCCATCGCCAAGTTCAGTCCCCGAACTGTGCAGTTGGACTCGCCACCTATCTGCACAAGTACTCAACGAATTTCGCCG
ACCTGGCATGCATGATGACACGCTTACTTGGCAAGGACGTTCCTTGGGCATGGTCCCAAGAGTGCCAAGTGGCCTTCGAGGCCGTCAAGGCGAGCCTCAC
CATGGCCTACCAGACTATTCCAGACCCTTCGTCGTGGTCTACAACGCATCCATTCGCGCCATCGGTTGCTGCCTGACGCAGTGCGACGATTCGGGCCGGG
ATCGCCCGGTATCGTTCCAGTCCTACCAGCTCCACAAGTCCGAGAAGAACTATCCTATTCATGACTTGGGGCTTCTGGCGATGTACTACGCCTTCAAGAA
GTTTCGTATCTACCTCCTGGGTTTGGAGGAATTCGTGGCCTTCCCTGACCACGAATCTCTACAGCGCTGGCTCTCCTTCTTTGTGGAATTCAACATGAAG
GTTGAATACAACCCTACCCGCGCGACAACGTTGTCGCGGATGTTTTGTCCCGACTCCCGTCGGTATACAAAAATGGAGCTCACCTTCATCTCCACGGTCC
ACTCGGATGGCTCGCATCCGAGCAGCTTACACAACTGACCCCGCTTTGGATCCGATCATCGCCCACCTACGTGATGGCGTAGCGATATCTTCTGGTATCC
CCCAACTCGACCGCTATTTGGTCCGTGGCGGTCTGTTGATGTATTCCACTAACACGACTGATTGCTCTCAGGTCGCAGTTCCCTGCGACCATTCTCTACG
GAAGGACATCCTGCACGAGCTCCACGATGCCCCAAGCGGGGGTCACTTCGGTCGCGACCGAATGTACACTACCGTCGCTCGACTCTTTTGGTTGCCGCGT
TTGTATAAACACGTTGCTCGCTAAGTCGCCTCCTCCGACGCCTGCCAATCAATCAAGGCCGTCGCGTCCACTCAAGCTCCACTCGCGAACTCTGGGAATC
CGTCAGTTTGGACTTCATCTTTGGCCTTCCCCGCGACCAATGCGGCAACACTGGCATTTGGGTATGCGTCGAGCGGGGGTCGAAATACCTTGTGGCAGTC
GCCGTCAGGGCGAGCATCACAGTTGAGCGCTGCGACGCGCTCTTCTTGGACAACATGTATTGTCGCTTTGGCCTCCCTTCTTCCATCATCTCCGATCGAA
ATCCACGTTTCACTTCTGCTTTCTGGAAGTTCTTGTTTGCCCGCATTGGCACTCGCCTCAGCATGTCCTCGGCCGACCATCCCGAGACTATCGGCCAAAC
CGAACGCGCTATCCGCGTTATCGAAGATGTTCTCCGCAGTTATG