Description :
From Genome Similarity Track
Location :
Scaffold_839:3390- 8760
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_839-fgenesh-gene-0.0Adaptor protein kanadaptin
Pytiw_DAOMBR242034maker-piw_contig_839-fgenesh-gene-0.1ATP-binding Cassette (ABC) Superfamily

Sequence
5370 bases(100 bases per row)
GAGTCGATCCAGGCCAAGATCAAGACTTTGGAGAGAGAGCTGAGCGAGATTGTGAGAGAGCATGCTCACGCCCAGACGCTCGCAGCCCGTGATGGAGGAG
GACAAGCAGCTCAAGAGCAGAAGCAAGACGCTGAGTCGGAAGAAGCGGACTCGCTCGAGTCGTTCATGGCGTCGACCACGAAAGAACTGCACTCGACGCA
GCTGTTATCGCTGGAAACACGAAAGCACGACCTGGAAGCGGAGCTGCGACGCCAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCCGTGCCCGCTGCAGTTCGCACGACTCAACCAACGCCC
GTGGCAAGTGAGACTTCGGTTTTGCCAACGATTTCAAGCCCATCACATGCGCAAGTAGCAGAGAAAGAGGTCGATGGTGGCGCTCAGGAAGATTTGGTTG
AGCCTCAGAGCTCTCTCAAGCCCAGTGTGTCTACAAAGCGACCAGCTGAGCCCCGAGAAGGAGAAGACAATGGTGAGTCAGAGCGTTCCGACAGTGTCAG
TGAGAAGCAGCCGTCGCTCCCAAAGGCGCAAGTGACCAGCGATATGACAGCAATCGGAGCGAAAACACAAGCGAGGCTCGAGGTTGTTGGCCTGGCGAAG
AAACGACGAGTAGTGGGCCCAGCTCGACCGCCTGCTGTTGCTGTAAAGGGCAGCAATCACAGTAAACAACTGATTGCGGCTTCTCGATTCGAAGGCGAGG
CGAGCACCCTCGAGGGAGGCGACAGCGTGTGGGTGCCGCCCACGAACCAGACGGGCGACGGGCGAACGAAACTCAATGACAAGTACGGCTACTAATGATT
AAGCCAACGCTTTTTGGAAGGTGAATATTTGTTTGTTCAGTATTTTACTTGATGTTTTTGTTGTTGTACACGTTGATATGTCTATGCCGTGAATGATGGT
GACGAGCCACGCTGCGAGTTGATGCGGTGGTGGGATCGGATCGATTGCATGCTGCTTGGGCGGAGCTGCTCAGCGGTGCCTTGAGCAAGTGCATCTCCGT
GTTGACCGTAGTGACGCGCGCTCGCATCATACGTTCCGATTGCAACCATACGCTCTTCGTCCTGCTGCGCGGCCATGTTGTTGAAGATGTGTTCGAGGGA
CGTTTCGCTCACGCCGTACTCGTTCACGTGGAGTTGACTCTTGTTCTCTTCAAGCAGCCCGAAGATCATGTGCGGTCGCAAGCCGTGCTTGGGCACTTGG
AACCGGAAGTGGTCACCCTGGTGCTCCACAAGCTCGCATCCTCGGAACTGGGTCTGGAAGAAAGCCTGTAGCGCGTTGCTTAAGTTCTCTGACAGCCACC
AGGAGCAGAAAATATCGACCGAGATCGAGCCCATGGACTCCAAATAGCTGCCAAGCACCCATCCGTTGCCCTCGCCGCTCAGGATCGCCTGCCCACGCTT
TGCAATCCCCAAGAGCGAGCAGACGTCCATCACTCTGTCTCGCGAGATGTTGTAGTCGCCGCCACCGGAGCTGCTGAGGAACTGTTCCACGGTATCGCAC
AGTCTCGCGACCGCCTCTTGTTCTGGCTCACGGATAGTCACTTCCACCGTGTACCCGCGACCGAACTTCTGCTTCAGATGCTCTACGCTTCCGAGACAAG
TCAGCTTGCCGCTCACCAAAATCCCCACACGTGTGCACAGCGCCTCGCACTCTTCCATGCTGTGCGTTGTCAGCACCACCGACGACTCCTTCTGCGCACA
CACAGCGGCGATAACGTCCCACATCTTGCGCCGAGAGCTTGGGTCGACACCAGTCGATGGCTCGTCCAGGAAGATGATCCGTGGTGCACCGATCAGCGCG
ATCGCGGTCGACACCTTGCGCTTGTTGCCCCCACTGAGACCGCGCGTGAGCTTGTCCTGGTACTCGGTGAGCCCCACTTCATTGATCTTCTCGTTCACCG
CAAATTCGACGAGGTTGCTTGGGATGCCCTTCAGTCGCGCATACAGCTCCAGCTGCTCTCTCACTGTGAGCAAGTCGTGGAGCGAGTCGAACTGAGGACA
GTAGCCGATCACCGTGCGTGCCTTGTCGCGGCTCTGAGAGAGGTCATACCCTCCAAGCGACACAAAGCCGTTAGTCGGAGCGATCTGACCCGTAAGCACT
TTCATCGTCGTCGACTTGCCCGCACCGTTGATTCCGAGATAGCCAAAGCACTCGCCCTTGGGGATTGCAAGGCACAAATCGTTCAGCGCTACTTTTCCTC
CGTGGCCGTACTGCTGTCGGAGATTTCGGATGAAGATGCTGTCATTCGCAGTTGGGCGCGAGGTCTCCACTTTTTGGCGCTCTCGAGCAACGTCGTCGTC
TTCATTTGCTGCTTGAGGTCGTCTCTGCTCTGACTTCCAAATCACATTTCGGTTCTCGATCACGAACACGAGGATCGTGAAAAAGATCGCTTCAAGCAGA
CAGTACACGACTGGAGCACCGGCGACGTCGACATCGAACACGTCACGATCGCAGCATCCGCTGATGTTGCGAGTCCAGCAAGAAACGCAGTTTGAGTCTT
TCCCAAGGCCCTCAAAGAGTCCGAAGAAAGACGACGGTTTAGGACTCGAGGTTGTTCCATAGAGCGAGTCACGGCTGAGCTTGCGGGATGCGATTTCGTA
GATACCGTTGTTCAAACTGTAGCCTGGGAAGAGCATGAACACCCACCGCAGGTAATTTCGATCCAGCTCCGACAGAGTGAGGCTGTTCTGGACACTTGGT
GCCAGCTCGAAGTTGATGATGCGACACAAGAACGAGAAGATGCTCAGCAGTCCACCAGTACCAAGAGCAAACACCAGCAGGGACGTTTGAGCCACCGCGT
GCTTCTCGAATCGGAATGAGAAGAGGTACGCCATCGGGATCACAGCGAGGGCGTGCGATCCGACCAAAGCAGCGACGCCGAGAATCTCCGATGCGTGGGA
GAGCGCGCGATTGGAGAATGGGACCATGATGGTAGCAGTCACGACAGAGACCGCGATTAGTACGATGTCGTGGGTCCAGCTTGACAGCCAGTAAGCGGAG
ATATTTGCTCCGCAAATCAACTGCAGACTTTTCGCATCCTGGATCGGATTCTTCTCGCGGACGATGAACGCGACGATAGCAGCTGGGATGAACGCGAAGG
CCAGCATGACGACGATAGCGACCAGGAAGCCATTTAAAGTGACTTGCAATTTGGCGCCATCGCGCTGCAAACAGTTGGTGTTGTAGCATGGCGTCTTCGG
TGTGGTTGCTTGGGTGACACTGCGACTGCACAAGTTGCACGCGTAGTATGGCGATACAGCATTGTACTTGTTGCAGCACGCGGTGGCATCACAGTCGATG
ATTCCCAGCGCGCAGTAGTCGAAACTATACGTCTGGCAGTTCTGCTGGTCACTGCTGTCGAAAGCCACCATCGTGAAGTTCTTCGCTGTGCAGCTCGTTT
GCTGAGCTGCGGACGCAATTCCGGAGGCATAGTTGTCAGGTAAAAATCCAGCAACCTTGATCTCAGGAAGCAGGATGAGGATGATCAGGAAGAGTAGCGG
GATGATGATCGCGTTCGTCAAACTCTTGCGGTCGCGCTTGGTGATTCGAAATCGCTTCATCACGAGTGCCGAGTACTGCATCCAAAATCCGGGCTGATTC
GTCATTGTCGAGGTGATTGAACGAGCTGTTGGCCGCGTGTACGCCGATGTGGCAGACGTTTTTCTCCTTTGATCAACACAGTCGACTTCGGCGAGGTTGC
CTTCCTCGCGATCCCTGGAGATTTGCAAGAACACTTCTTCGAGCGTCGTCACAGAGATACCGTACTGTACCACTCGGAGTTGGGCCAGGTTCGCATCCAG
TGACTGCAACATCGTTGGAAACACCGCTGACGACGCCGACGGCAGCTGGAACACAGCTTCTGAACCAAAGTTGCTCAGACACTTGGAATCCGGAACGAAC
TGGCGCAGGTACGCGCTCAGCGCTTCCACGTCACATTGCGGCGCCTTGATCATCGTCAGGTTGTACCCGGCGCCGTATCGGTTCTTTAAGAACAGAGACG
ACCCGGCGCAGCAGATATCTCCGTCCGCCATAATCGCAATCCGGTCACCCAGAATGTCGGCCTCGTCCATGAAGTGCGTCGTGAGAACAATCACACGGTC
GTCGCGGTTGCGCTGCAGCAGGTTCCACGTAAAGCGGCGGGAGTAAGGATCCATGCCGGATGTGGGCTCGTCGAGGAACACGAGCTTGCTGTCGCCGATA
AAGGCAATCGCGACACTGAGCTTCCGCTTCTGGCCACCAGACAAGTCCTTGGCGCGCGTCTTGCGTTTCTCCGTCAGCCCGACCTCTTGAATCATCTTTT
GAACTTCTTCGCTGAGTTTGTGCGGTGGCACATGCTTCATAGTGCCGAACAAACTCAAATGCTCTTCGACGGTCAGCTCGTTGAGCAGCACATCATGCTG
TGGACAGATGCCCATGATCTGGCGCAGCTCGTTGAAGTCGTGCTGCAGGGATCGTCCGTACAGCGTTGCGTCTCCCGAAGTCGGTGTGATGAGACCCGTG
AGCATGGAAATGGTGGTGGTTTTCCCAGCCCCATTGTGCCCAAGAAGCGCGGTGATGTGGCCAGAATACATGGTTAGGTCCAGCTGGTTCACGGCGACCT
TCTCGACGCCGTTGTCGCCCGGGAATACTTTTCGAAGACCGCGAATCTGTAGACACGTCCCCTTCTGCTCTTGAATCGCCAGCGACTTGTTGACTGGCTC
GACACTCTTGCTCAAGTTCGCATCGTGCTTCATCACGACAATCGATCCATCACTCGAAAACTGGTGCTGGAGCGTCATGTTTGGCCCCGAAGAATACGGA
CTCTCCGTGCGAGGAGACGAAGTATCACCGTCGCGAGGAGTAGTCACAATGAACGACTCGTCTTCCTTCTCACGCGGCTGGTTGGTCCAATATTCTCGCT
TGAGCATGAAGTTCCAGGGCTTGCGAACGCCGTATTGCTGCGGCAGCACTTGCTCCAAGTACCAGCCCAAGGCGAACAGCAGGAAGGAGTCCAGGATTAG
GAACCAGCTCATCTTGAACGCGCTCGGAACGGTGACTGGTGACTCGATGATGCCGATAGCATACGCGAACCCAGTACCTCGTTGCGCTCGACGGAGTAGA
TCATCCACGGCAAGAGCAAACGCAGTCGGTGGCGACAATGCGGCCCAGTATTTCTCTGAATTCGACTTTG