Description :
From Genome Similarity Track
Location :
Scaffold_2761:339- 2791
Transcript NameFunction/comments
Phyta_totarag14809hypothetical protein

Sequence
2452 bases(100 bases per row)
AGACCTAACGATCTACGCGTCAACCTTATATGAACTCCGGGAGGCCGACTTTTACGAAATCTCGAGGAAATCCAAGCGTGATCTGAAGGCGCCAAGGCGC
CATCTGGGTATCAAAGATGAAGATCAACCCAAAGAAGCCGGAAAATGGAACCGGGCGGATGTGGCATTGGCTACCCTGAAGAATAAAATCGCTACAGCAC
CCATCCTACAACACTTCGACCCAGATCGACGACCGGTGATTATAGTCTACGCGAGTAAGTGGGCGATCTCGGTAGCTTTGATGCAGGAGCATGACGGGAC
GGACAAGCCTGTGACATTCACCAGTCGTCCGTTGAAGCCTAACGAGATCAATTACGGTATTGTGGACAAATgagtgctggcgctgctcagGATGCAGGAT
TCCTGTTATACCCAACTGGTGACCCGACCCATCAAGGTGTTAACTCGATATTCCACGTTGGTCTGGCTGGTTCACTCATCGGGCTTGCAGGGACGCTTGG
GCAGGTGGGCCGCAATTCTTTCTAGCTGGACGTTGGAGGTCGTCAAGTGCACGAAGGGCGAGGATGAAATTTTGGGTGTGATAGCGGCAAGCATTTCTCC
ccgagaagaagttgacgcgATCTTGACGTCGATCGCACCGCGAATAGAACCTCGTCAAGTGATATCGATGCCCCCTCCCACGGTGGAACCCGAAGCAAAA
CTGCTTGTAGTAAGTTTCGACGGATCgagcgaggtggaggagcgTATGGAGCAATTGTGTGGAGTCTACCAGAATGGACAGTGATCTCTGCCGCGTCTCA
GTACAATGTCGATCTTACCGTAAATGAGGCGGAGTACCATGATTTGCTCCTGTGTTTCGATCTCCTGTCCCACTTGGACAGGGGACGGCTGATTATATGT
GGAGATTCAATTTGGTGATTCGACAAATGCGCAGCGAAATCGAGTGTAAAGCACCAGGGCTCAGATAGTTGCGTAACAGAGCGATGGAACGTCTGCGATC
TTGGCCGCGCCACGAGTTCCTCTACATGAAGAGAGACTGGAACCAAAGTACCGACCGAATAGCCGGTGCGGCGCTCCAACGTGAAGGGAGTGACGTAGTT
ACGACTGAGATCGAGCGCCAAGATTTGAGGACACTAAATCGACTGAGCGAATTGCTGGTTCCACAAACGAGGAATTCTACCGTGAAGATCTCGGCTGTAA
CCAGATCACGCAAGCGACGCAGCCCTGAAGTCCTGATTGAGGAGATCGTCCAGCAGTTGAGGGCCGAACGTGTTCTTCGAGCGCGGAACGAAGAAAAGTG
GATTGGCGATCTCAAAAAGTACCTGCAAGGGGACGTATAAGATCTCAGCTCGGCAGAAGCAAAAACCTGCGCCAAGATCGCGGAATATtatgagatcgac
gaggatGGTTTGCTTTTCTACTGCCCGCCATCAACGCAGCCGCGTGAAGATCGTGATCTTATCGCTCTATTGGTCGTCCCGGAGACCCTGCAGAAGGAGT
TCCTGCACCATTACCACGTCAGCTTGGAATGAGGACATCAAGGAGTCGGACGGACTTACCAGCGACTGCGAGCACATTCTCACTGGAGAGGAATATCTCA
GAGCGTGCAGCAATATGTGAGGCGATGTGGGGATTGTGAGACGGGGAAGAGAAGACCTGTTATCCTAGGCGAATCACCGGGTAATTTACAGGCGACCTAC
CCGTTTCAGATCATCGCGATGAATCACATCCCATCGTTACCTCGATCTCATAAGGGCAACGCTGAGTTGCTGATCTGGGTCGACCTCTTCACCGTATTTG
TGATCGCCAAAGCTAGCGCCTCCAGGACGGCACAAACAATTGCGGGGAACTATGAAGAGTGCGTTTTCCGGTGTTTTCGGTGCGAGTGAAGCAATCCGCC
ATGACCGAGAACCCGGGTTTATGTCGGACTTCTTTAGATCGTTCAATAAGATCGTCGGCCAAAAACAGCTCGCAACGATGGCGTACCGCCCACAAGCCAA
CGAGACGGCCGAACGGATGGTGCAGACACTAACCCAGTCGTTAAAGATGTACGTCGTAGACGTAGACCAGAAGGACTGGGATGAGTTAGCAGAACGCCTG
AcgttcgccatcaacaccgctcaagatcgagtgCGTGGAGATACACCCTTCTATCTGGTTCATGGCTGGGACCCGCGATCTACACTAGAAGCGATGATAC
CACTGGGATCGACGCGTCGCCGAGATCGTGGCCCATAAAGATGGTGATACCACATCCAGAGACACTAATGTGGTGTAAGAATCATCAAATTGGGACCGAT
CATAAACCAGGACCGCCTAACATAGGTTCAAGATGAATTTTAGGACTGGTGAAGTACGGTACTCGGTCGTTTCACccagtcgctgagttcaagagtcGCA
GAATTTAaagatcgccaagctggagagtCGCCAAGCTAAAGAGTCGCTCAGg