Description :
From Genome Similarity Track
Location :
Scaffold_3481:339- 2533
Sequence
2194 bases(100 bases per row)
TCTCTGGCGCGTCAGGCTCGTCGGTCTGGTCGCCCGACGCATTCTCCGCCTGCTGGTTTGGGTCAAGAATCGCTTGAGTCGCCCGACGTAAAAAGTCGGG
TGGAGTCAAAGTGACGACGGTATGTCCAGGGTGTAGGCGGCGCCCACAGCCTTGGGTACTCGTAAAGGACCGATAAAGCGTGGAGCTAGCTTGTTGGCGC
CGAGGTTGGTTACGGCAGAAGCGCGGATTCCCTCGGTCGATAGGAGAATGCGATCTCCTATTTTTAATACATTCACGTTCTTTCGACCGTGCTAATCAGC
TTGTTCCTTTTGCTTGTCCACTGCGTTCTGCAGTGCGTCGCGGACGAACCTTGAGATGGATTGCCTCTGCATGAAGAATTCCGCAATTGCCGAGCGATCG
GCTGGAAGCACCGAGGGTTTTGGTGTATAATTGGCCGTGATAACTTCCTGCTCGCGAATCTTGCTGCCTGGATCGATCAAGTTCCGCGATGTCCATCTCG
TTATCGGAGATGCAGTACGCGGAGGAGTCTCGATGGTCTGCTTGGACGGAGAGCGAGTCAAGGCGCTCACACTGACTACACCCGAAGATAACCCTGAAGT
CGAGTGCGCCGGCAGGCCTGTTATCACCGGTGAGATTACTAGTGCGCGCTGAGACACCGGTTCACGTACTGAAGATGACCACGACACGGACTCGCTGTCC
GCAGGACTGACCGCAGCTTCAGCATCCATGTCGACCGAAGGAGGTTCTCCCCCACCAAGGGTGGAGCCGCCAGCATCTGTGGGGTGGCCTACGGCGAGAA
GTGCCGGAACACGTGGGTGCCAAGCGTTGTTCACAAAGAACGGCGTCATGCCCCGTCGAGGAGTGCTCGGCGTTCCTGAGTGCAAATTCGGCTAGCGGCA
GGAACGAGCTCCAGCTCGTGTACGAAGTCGCGTAGTTGCGGAGAACGTCTTCAAGGACTCGGCTAACGCGTTTTGTTTGTTATCCGTCTCCGGATGCACC
GCGGTCGACATCAGCGGTTTAGTTCCCAAGCGCTCGAAGAGGCGTGACCAGAACGCGGATGTAGGCCGTGGGTCGCGGTCGGACACGATCGACTCCGGCA
GGCCGTGGTGACGAAAACTCACGTCGCCGAAGTGGGCCGCGGACTCTTCCGCGGTGACCGGGGCTGCCACAGAAACGAGATGAACTATCTTGCTGAAAAC
GATCGACGAATACAAGTACAACCGTGCGCCCGGCTGTATCGGGCGGAAGACCGAAGATGAAGTCCATCGAAATGGAGCGCCAGGCTTCCGTGGCGACCGG
AAAAGGGCGCAATGGGGCCTGAGACGTCGAAGACGGTCTGACTCGCTGGCAAGTTTCACATGTGCGGAACCACTTGCGTACCCACTTGTATATGTGCGGC
CAATAGAAGTCTCTCGACAGAGCCGCGTACGTCTTCTCGCGACCGAGATGTCCTCCGGTCGGGGCGTCATGGTACTTGTGGATTATGCGCGCACGTAGAT
CAGCGTCGTTTGGAACGACGACTCGAGGTTCATCGACCCTGTCGATGCTGTACTTCAGCAGATTGCCGTCCGGTCGATATCGATCTAACTGATTACGCGT
GGTCTTTGACAGGGCACTAAGCGTGTCACTACTAGGAGCGCGCAGGTGCTTCATGATGGCACCGTATATAGGATCATCATCGTACGCTGTACCAATCTCG
TCGCCCAGCGGGGGCGTGGGCGTGGTCAGCGTCAAGTTGATGCCTGACGACACGCAGACCGCACATTCGTCGTCGTCCTCATCAGCCACCTGATGTCCTA
GCGCTTCACGGGGATCGTAGTCCGGACGCCGAGACAGCGCGTCGGCAAAACTTTTATTCTTGCCCGGCATGTAGTGAACAACGAAGCTGTACTCGGAGAA
GAAGGACAGCCAATGGGTTATTCGTTGCGACAAGTGAGGGCTCTTCATTGCTGTCCGCAGCGATGCGTGATCAGTGTAAACCACAAACGACTGTTCACCG
AGCAAGTACACTCTGAATTTGATCAGAGCGTGCCGCATTGCCAGGAGCTCCTTGTCGTGGACTGGGTAGTTCTTCTCGGCTGGCTTCAGCTGTCGCGACT
GATAGCTGATAACGCGTTCATGTTCGCCATCAGCGAACTGCATCAAGGCACAGCCGATGGCAAAGTCGCTTGCGTCGCACCCCACATGGAATGG