Description :
From Genome Similarity Track
Location :
Scaffold_3600:339- 1817
Sequence
1478 bases(100 bases per row)
AAACCCGAGGGCGTCAATGGCGCCCCCGTGCTTGGGTACAAAGTGGAAGTGGCACGACGCGTGGACGAGGTGCAAACATTCTCCGTGGCAGCGAATGGGC
CCATTCTATCGGGCGGGTATAAAGTTACGTTCAAGAACAGTCGAGGCACCGAGACGACGTCGTGTATCCCGTGGAATGCCAGTGAGGTGGCGCTGGAGAT
GGCACTGGAAGAACTGCCCAATGTGGACAGTGTCGGGGTCTCGAGATCGGCCTTTGGGGCTGCCAAGAACGGATTCGTCTACCGCGTCACATTCGACGGC
GCGTATCTCGTTAGTGGCCGACAATCGGATTTATTGGTGGGGGATACAACGAATGTTTCCATTGGAGAGGACTATTCAAGAGTGTACATCGATATGTCGG
TGAATGCGTGGATTGTGAGACAGGCAAAGGCAGACCTACGATCGAAGGGGAGTCACCTGGGAATGTCCGAGCGACTTACCCTTTCCAGATCATAGCCATG
GATCATATTCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATATGTGATTGCCAAAGCTAGTGCGT
CTAGAACTGCGCAAACCATTGCGGAATCGTACGAGGAGTGTGTTTTCCGAAGATTTGGTGCTAGCGAAATAATTAGACATGATCGGGAGCCAGGCTTTAT
GTCTGATTTCTTTCGAGCATTCAACCCGATCCTAAGGGCAGCGACAGCAGGCAACCATGGCGTATCGTCCCCAAGCTAACGCGGTCGGCCGAAACGCATG
GTGCAGACGCATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAAAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACC
GCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCAGTATGCAGTACCAAGA
AGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAATGCGATACAGGA
TCGAGCGGATCGACACAACGAAGACGCCCGTCTACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGC
AAATTGGCCCATCTATGGCATGGACCGTTCCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCATGTTC
CCTGTAGTACACGTGTCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGTATCCGACCGCGTCGACTTCGACG
AAGTCCTCCTACCGGAAGACAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGA