Description :
From Genome Similarity Track
Location :
Scaffold_24:338984- 340094
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11337ATP-binding Cassette (ABC) superfamily

Sequence
1110 bases(100 bases per row)
GGCGAGTGTTTTGGTTTCTTGGGGATCAACGGTGCTGGCAAGACAACGACCATGAAGATGTTGACGGGTGATATCGTGCCTACCTCTGGCAATGCCACGC
TCAGTGGATACGACATTTTGACGCAACAAGTGGAAGTTCGTCGCCAGATCGGCTACTGCCCGCAGTTCGATGCACTCATTGACTTGTTGACTGTACGTGA
GCATCTCGAGTTGTTCGCAAAAATCAAGGGAGTCCAGAGCTCGGACTTGGATTTCGTAGTGCGCGAGAAGATGGAGCAACTGAATTTGACGGCGTTTGAA
GACAAACTCGCGGGTAGTTTGAGTGGCGGCAACAAACGCAAGTTGTCTGTCGCTATCGCGATGATCGGGTCACCCAGGATCCTGTTCCTTGATGAACCAT
CCACTGGTATGGATCCTGTCTCCAGACGGTTTATGTGGGATGTCATCTCCGAGATCTCGACGTACAATAAGGAGTCGACGGTGGTGCTGACCACGCATAG
TATGGAGGAGTGCGAGGCGCTGTGCACTCGTGTCGGCATTATGGTCGGTGGGGAGCTCAAGTGTCTCGGCAGTGTGCAGCATTTGAAGAATCGGTTCGGT
GACGGACTCATGTTCGACGCGAAGTTGCAGACTCCATCTGCAGAGGACGTCTCTGAACTTGTCCTGCGTCACTTTGACTCGGTCGACACTCGCATCGAAG
AGGGAGATCTCACAGAGACTTGTCAGTTGTTCGGTAACGCGGCATGGACACAGAAGATCGTCAACACGCACCCGACTGGACACGCGATCGCTAACCTTAT
CAAGCGTGATGGATACGTCTCTGCCAATAGCTTCGCGGCGTGGTGGATCACTGAGACGAAGTTCGAGAATGTGTTGGCGTTCTTACAGGAGAACTTCAGG
TCGGTTGAGCTGCTGGAGCGTCAGCACGATTCGTGCTGGTTCAAGATCCACGACCAGCCAGCAGACGACGCCAATAGCCTGCGTCTGTCGAATGTGTTTG
AGCTGGTGGAGAACGCCAAATCTCGCTTGTCCATTCGCGAGTACAGCGTCTCGCAGACCACATTGGAACAGATCTTCAACGCCTTCGCGAGCCAGCAGGA
TGTGGATGAG