Description :
From Genome Similarity Track
Location :
Scaffold_1795:3389- 4835
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1795-fgenesh-gene-0.1GPI-anchored protein

Sequence
1446 bases(100 bases per row)
TGGGGTTTTTGGCGCCTTGGTCTTCTTCGGCTTCTTCGTGGTAGGCATCTGAACCGCTTCGCCCCCAATCGACGCGCCGTTGTCGCTGATGACGCCTGGG
ACGACCGTGCAGCCGCTCTTCTTGAGCTTGCGCTTGATGGTCTTCTTCTTGAGTACGCGGGACGTCGTGTTGCCCGAGAGCTTGCGGTGGCCTTCATGGA
CCTGTTCCATGGCACCGGCAGCGTTGGAGGTCACCTGGAGGCCTGCCACTGGGGCCATTTGGCTGGACGAGGCGACCGCGAGCAGGAGCGCGAGCGCAGA
GACGTTGCGAAGGAGCGAGCAGAGCACCATGTTCTCTGATCAAGCACTTGGGTGGCGCAGAGGCAATTGGGGAATGAGCGAAGAGCTGCACGGGCGAGTG
TTGAGGCGTGGGCTGGTGGCGGCGTGGGTGGGTGGTCACATTACCTGTGCATGAGCGTGAGCTGGCGACAAGGGAGAGAGAGAGTCAGCGTCTGGATCGG
CTTGTGTCTGCTCCTCTGCATTGCTGCTGCGCCGGAACCAGCTGGCGGACAACATCATCCTGTTATAATGCTTAGAACTGTGCACTTGTGTGAGGTGAGG
TGAGGTAGTTTAATGTGTATTTTTCATTTTTGAAGGGTATTCATATTTAAAAAGGTATTTACCAGTGTCATCAGCTTGTCCAGTTTTCACATCTGACGAA
CCAGTTGGGAGCTGGGAATGGAGACGACCGGCGAGTCCGTTCATTTGTAATTTATGATACGTGCACCATTTTCACATGGCACAGGTTATTATCTAAAAAA
GTCCGATTTAGTACATAAAACTCAGTTTTCATGACTGATTTTGTCAAAAGATTGAATATAATAGGATTGCATTTGCCAGGAATGAGGACACATCCAGTTG
CCATCCAGATGGCGCTCAATCTTCTTGCGGTCAGCACTGCTGATCACTTCACAATCACTCGGGGCGCGTAATCCGGAGAGAGATTGATCCTCTGGGGTCT
ATTTGCATGACGGTCATGCTGGTAGCGGCATGTAATCCGAGTCGCGAATGTGCTTCTGGCGAATGAGAGGGACGAACCGTCGCTTCTATTGGTCGGTCTC
TCAAACGAGACCATTCAATTAACATTTTTAACGACACTCAGCAACATGCGGGTGTGCATTATACACGCTGTTCAGAAGCTTTTTGAGGATCCCAACCGCA
CGCTTCACTTGGGCGTTACCATCAGAAGGGGATTGGCGGAATTATTGTGAGGGAAAAGATGACTGCCGCGCAGCAGTGCGATCGCAACGAGCAGGTCTCA
TCAAATCACAGTAGCGAAGGCTGTGTTTACACACCGCAATTTGTCATGTTGCGTGAGTTTTTTTCTTTTGAAGCTGGCGATCGCACGAACACGACGCGAA
AACATGGTGCTGCGCGAAAACCAGCTGATGGGTAAGCTCCAGGATT