Description :
From Genome Similarity Track
Location :
Scaffold_1929:3388- 5187
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1929-snap-gene-0.5Leucine-rich repeat-containing protein 56.

Sequence
1799 bases(100 bases per row)
GTCTCGACAAAGGCCTCCTTGACGCTTACGCCATTACGCAACACGCCGGCCGACGTGTTGGGGCGTCTCTCAGCCTGAGCTGCTGCTGCTGTTGGTGTTG
CTCGCTTTGAGCGACTCGCAGCCTTCCGCTTGGACAACGGACTGCTGCTGTCGCGATGGAGGGGCGGGACATGGGTCGCACCGAGCTGCGAGACCGCACC
TTCCTGCTGCCACGCCTTGAGTTCGTTCAAGATCGCGTCGCGGGACTTGTGCTTCTGCGTCTCGAGCTCGTTTGCGCGATCGAGAGTGTCCGTGATCGAC
ATGCGTGCTGGCGTCTTTGGTCGCTCTATGAGAAGCGGTGAGACGCATCTACTGCTGTTGGCGCTGTCATGGCTGGGGTCGCTGTGGTCGCCACAACCAC
TGACCGCGAGCTGCTGTGCGAGCGCCACAAACTGCGCATCCGACTCGTTCTCGCTCCGATGGCGACGCAGTGAGCTCGTGACGTTGCCCGCAAACACAAT
GTTGGTGCCGTGCGTCAAGCTGCTGCCCGAGTCACTGTTCCTCGCCTCCTACAAAGACGCTCAAATGTTAGCAATGGAATGGTGGTGAATCACTTTACCA
AACTGAGAACGTACACTGGCAGGATCGACTCCAGTGACTCGCTGGGTGCTGGAGCTACGAGAGAGCTTGCGCGGACTGCCGTAGCAGCTCGACGCCTTGA
TGCCGTCGGCGATGAGCAGTCGGTCGTCCACCGTCGCTGGCGCGGACTTGCTCGCCGCTCCCAGCTCCTCTTGGTGCATCTTAATCGCCGCGTCGATCTC
CTCGTCCGAGATCTTGGCTCGCTCGGTGTCCGTGATCAGCTTGTCGTCCAGAGTCGTCAGCTGCGGCAGGAAGTTGGCGATGATCTGGCGGTAGTGCGCG
ATTTTGCACACCGGGTTCGCTTCGAGGTTGAGCGTCGTGAGCTGAGCACAGAAGGCTAACCGTGTGTGCCATAGTTACAATTAGCTCATCAAGTGATCAA
TTCGACAGCACGCACCCAAGCCAACGACGTACCGAGCTGCTCGATTTGGCCAATGTCCGCGACGCAGTTGCCCTCCAGATCGATCACTTGGATATCTTCG
TGCAGCATCAGCGGGCTGAGGTCGCTGATGTCATTGTACCGCAGGTAGAGCTCCTGGAGACCGGTGAGTGCGCCGATGCCGTCCAGGTCGTTGATGCCGC
TGCGCATGACCCAGAGGATCTGCAGCGCGTGCAGCGACGTGCCCAGGTCTCGAAAGCTGTGCAACGTGCTGTTCTGCAGCTTGAGCTGCTGTAGCGACGG
CAGCAGCTCGCCGATCACCTCAACCGACTGCTTGCCCGAGTCCACAGCAAGCTGCAGAAACGTCACGCGCGCCAGGTCCTGCTTGCCGCTGAGCTTTTGC
TGCAGCGGGCATGGTAAGAGTCCCGTTGTCAGTGCGAACAGTATAGGAACCACAACTATGCACATTCGTTTTGCGTACCAGTTTCTCTTCGGTGATGTCG
TCGAACGGGTTGTCTGGCAGGTGCACCTCGCTGTCAGCTGCTGACGTGTGGAGCGTCTTGTGGTGCGGCGACGTGCGAGCCGAGGGCGAGAGCAGCTGCG
TCCCACCACAGTTACTACTAGAAACGCTGTGGTGCGCTGTCACGGGTGTCGGGTTGCAGTCCTTCGGCAGCGTGCGGATGAGGAACTTGGCCTTGGCCGG
TGCTTTCGCGACGGCCGCGCGGCTCAGCAGCGCCACGTCGTCCATTTCTTCTCGCAGGTCGATCGTCGGCGCCACGAGACTCATGCTCTCTCAACGAAG