Description :
From Genome Similarity Track
Location :
Scaffold_2:338773- 345947
Transcript NameFunction/comments
Physo_325852myosin heavy chain

Sequence
7174 bases(100 bases per row)
GATGTAGCCATGGAGTCGGTCAGTTCGCGTTCTTCGACGAGGTCCAGAACTCGACGCAACGCAGACGAGGACCCCGATGACCTGTTCGACTTGGACATCG
GAGTGCCAAGAACCGCGGCCGCCGTCTCGACGGCGACAGCCGGCGGCGTAGCCCTCGCCCGCGTACGCCTCTCAGCATCTCCCGAGCTGAAAGAGTTCTC
GGGACGGGACGCCAGCGAAGAGAAAGCCAGACTGTGGCTCAACCGTCTGAAGTCCGCCGCGCGGCGCGACGGGATGACGGGCGAAGAAGTGTGCGGGCAG
TTCAGCGATCTAAGGAGCGGCCCTGCGCGCCAATGGTATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCGAGCTGATGGAGCAATTCCGTGTGC
AGTACTGCGGCAGGGGCGTGTCAATGGCCAGCCGCTACTATCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGATTACTTGTACCGGCTCAACGTCGC
GGGCTTGAGGGCCAACATCCCATACGCCGAGGGTATGACTGAAGAGAAGCGCGAACACGTCGAGCATTTCATTCGGACGCTGAACACACAGGAGGCCGAA
CTCGCCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCGACAACGGGGACTGGCCCACCAGAAAAAGTCTC
TCTTCGGCTCGAACAAGTTCCGCCAAAAGGCGCCGACCCCACCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCACGTCGCGTCGGACGAGTACGATTC
GGGACGCGAAAGTCGCGACAGCGACGATCGCCAGTACGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTCGTCGCGGGACAGGCCCCGCCGGGA
GAGTCGGCGCGTCGCAACTTCGATCCCGACGACTCGAGACGCGACCGCCCGTGGTGCCGCCACTGTGGTTCACGACGCCATGTCGAAGGAGACCGCTGGA
AGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCCGGAGAATGCCC
GATGGAGGAGTTCTTCAACCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCAGGAATGCTGCCGCCGGCCGCCGAGAAGATGTTAAACTAGGACGCT
CGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAGGTGGTTAGTGAGAGCCCGACTTCCCT
GAATGATAATACATGTGAATTCAACCTGAAACGTACCACGCATGAACGCGCGCCGCGAATCTCGGCGGTCCGACGTACGACGGACGACGAGTTTGCACGT
GAACCACCCCTGGACGAGATCGACTTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATG
GAAAGCTGAACAACCGCCGTGCTGTGATATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGCTCGTGAGGTAGGCTGCCTGATTGA
CACGGAGATCACGCAAGAGTGTGTGGGAATTCGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATTACCTTGGCTGGGAACTTGGTGTAT
TACATGCACCTGTGGGTCGGCGACTTGGTCGGCCAGCACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAGTGCGCATCGACCCTGCGGACGGCA
CGGCGTGCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACGGCGCACGGATGCCCCCGGTCAACGTCAAGACGCCTGTGAGGCT
CGAACCAGGAGACACACATGAAGTCTTGCTGAGGCCGGATCGAAACGCGCCGTTGCTGTGGGTGACACGGGCAGAGTCGTGGGTGACTACCTTTGCCAAG
GGGAGAGTCGGAAAGAAAACGTACCTGCGTGTCACGAACATCGGAGACGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGTGGACGCCGTCTG
ACGGCCAGCCTCGGAACCGTGGATTCGTCCGACTGGGCTCCACCCGGTACCAGCAGTGGCAGAATCTGGCGTACGGCGCGACGCGCGACGCGGAGGAGAA
CTGGATCCCAGCCGAGCTCGACGGACCGATGACGGATCGCCCCTCATACCCGACGCCTACAGCCATCTTGCGCCCGGAGCCGAGCCAACTCGGGACGCGA
CGCGCCGTGACCCCAGTGTTGGCGGCTGTCGCGGAAGCGCCGAAGGGAAGGGGGGTAGACTTGCCACCCGACGACCACAAGCCGGATACGGACGAGGAGG
CGGTGGAAAGCGAACCCGATATGCCTCCGACTGTGGCTGGAAGCGCTGCGATGGAATGGAAGAATCGCCGGAGTCGGAACTCGCTGAGCCAAAACTCGAC
GGACCAAACCCCGCCGAGCCGAATTTCGACGAGGCGAAACCTGATGAGCAGGAGAAAGACGACGCGGTCCTCATCCACGAGGGGTCCGACATCTTCGTAG
AGGATCTCGAGTCTGAGATGGCAGTGCTGCCAGACCTCTTGCTGACCGCCGAGGTGAAGATCGAGAACTTGAAGGTCGGCATGCCGACTGGACTCCTGCC
CGAGGAAGCCGTGAGACAAGAAACGCGGCTACGCCAAATCATCTGGCAGCGACGGAAGTGGTTGATCGGCAAAGGCAACGCCTTGCCGCCGGCCGCCCTG
GGTGTTGTCTGCGACATCGACGTGGGCGACGCAAAACCCGTCGCGCAACGCGTCCGGCAAATCCCGCCGCAGTTTCGAGAGAAGGTCGCCGACTTGATCA
AAGGGCTGCTGAGCGCGAGGATGATCTAGAAGTCGAAGTCGCCGTGGGCGTCGCCCAATGTCGTGATAATAATGAAGAACGGCGTCGATATCCGGCTTTG
CATTGACTACAGGCTCATCAACGGGCTGACACAGTTGATGATTTACCCCATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGCGGTAC
TGCTCCCTCGACATGGCGAGCGGCTTCTGGGTCGTCCCCATGACAGACCGGGCCCGGCTCATCTCAGCCTTCATCACGCCGATGGGACTGTACGAATGGC
TGCGTATGCCGTTCGGCCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATGAAGCTGTCCCCGGGTGGCAGCAC
TCGGGACGTCTTTCAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCATTCTGGGACGGAGGTCGTACATTGACGACATCCTCATCGGGGCCACGTCG
TGGGACGATCTGTGCGAGAAGGTCGAACGCTTGCTGGACGTCTGCGAGCAGTGGCACTTGTCCATCAGTGTCGAGAAGAGCGAGTGGGTTATGTCCAAGG
TCGACTACCTGGGCCACCGAGTCTCAGGACTCGGTCTCGAGGCGAAGCCGAAGAATCTGGAGTCGCTGACGTCGCTCGAGTTCCCGCGCACGCTCAAGGG
CCTGCAATCGTTCTTGGGTAGCCTCAATTACTACCACCGGTTCATTGCAGACTTTGCGGTGTATGCAACCGCGCTGTATTCGCTGACGGAGACCGACTTC
AACGAGTACGTCGCGCGTCCAGAAGTCCGCGGGCATGAGAAGTGGACGCACGCGACGCGCGCCTTCGACGCGCTCAAGGCAAAACTCGCCGAGACCCCAA
TGTTGAAACACTTCGACGCGAACCGAGAATCCGTCGTGATCGTGTACGCCAGCGACTGGGCCATCTCGGGGGTGCTCACGCAGGTCCACGACGAAGTGTT
CATGCCTGTGAAGTTCACCAGTCGTACGTTGAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGTCCTGTTGCGCGTCTTAAACGAG
TGCTACACGATGCTAGCTCCTCGTCTTAACACGTCACACGACACTCGCCTGGTTGTTCCGGTCCAAAGGACTACAGGGGCGACTGTCACAGTGGGCCGCA
ATCCTCTCGCCGTGGAAGTTGGAAATCCGCCGATCCATGAAGGGAGAAGAAGGACTCCTCGGCGCGCTGGCCGCGAGCATTACCCCGCGAGCCTTCGTCG
ACGTGGCGCTAGAAGAGATCGCCCCATGGAGACGGGCGTCCAGGATTGTAGTCATTCCAGTCCCCGACGTGGCGCGCGACGAGGTCCTGCACGTCTTGAG
CTTTGACGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCCGAACTGGGAGATCGTGCGCGCCGCGTCGGGATAT
GCGACGTACCTCACGGTCAACGAGGCGGAATACCGCGAGCTGCTGCTAGGATGTTCTCTTCTAGAGGAGCTCGACAACGTCACCCGACTCGTCGTATGCG
GAGACTCCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGGCTGCAAGTCCCCGGGGCTGAAGCTGCTGCGACAAAGGACGCGAAACGCACTCCAGGC
ATGGCCGCGCCACGAACGCTTCCACGTACGACGAGACTAGAACGCGAGTGCCGACATGCTGGCTGGACAAGCTCTGCAGCGTCAAGGAGGCCGCAACGCG
CACAGCCCCGAAGCGATTCAAGATCTGAAGACGCTGAATCGCTTGGAAGAAGTCATCCGACCGCGGACATCGAGTCCCGGGATGGCGTCTCCACCCAGGC
CCGACGCGGATAATCTCGACGCGGAAAACCTCGACTCGGAAAATCGCGACGCGAAAACGCGCGGCGTAAATGACCCCGCCGGGAAGCGGGACGCGGGACA
GCACAAGTCCTCGCTGTGACAACGCGCTCGGCTGCCGCACGCACGACAACACGTAGGGTCCGACCTCCAGAAGTCTTGGAGGAGCTGGTGGTGCATCGAC
TGCGCCTGGACCGCATCCGCGTCGCCCAGGACGAAGAGGTCTGGATCGTCAACCTCAAGAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGA
GGTGAAGAACTGCCAAAAGCTTGCGCCTCAGTACGAAGAGGGCGAAGGCGGGCTGCTCTACTACCAGCCGAGATGCGACGATTCCGCCGAGGATCGCGAT
GTGATGATCAAGCTGGTGATCCCGGAGACTCTTCGGGAAGATGTACTCCACCACTATCACGCGAGCCTGGAAGGCGGACACCAGGGTATTGGCCGCACGT
ACCAACGCGTGAGGCGCCACTTCCATTGGCCAGGGATCTTCAGAAGCGTCCAGCGTTACGTCGGCGAATGCACCGACTGCGAGACGGGAAAGGGTCGGTC
GACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGC
AACACAGAGCAGTTAGTCCGGGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCGTCACGAACCGGGCAGACGGTGGCCGAGGCGTACGAGG
AGGCGGTGTTCAGGCGCTTCGGCGAGAGCGAGGCTATCCGCCACGACCGCGAGCCGGGCTTCATGTCCGACTTCTTCAAGGCGTTCAGCAAACTCATGGG
TCAGAGACAGCGAGCGACGCTTGCTTATCGTCCCCAAGCTAACGGTGCTTCAGAACGGATAGTGCAGACGGTTACAAGAGCGATCAAGATGTACATCGCA
GACGTCGACCAACGCGACTGGGACGAATACGCCGAGCGTCTTACCTTCGCGCTAAACACGTCGCATGACCGGACCAGGAATGAAACCCCGTTCTTCTTAG
TGCATGGCTGGGATCCTCGGTCGACGCTGGAAGCGACGCTGGCCGTCGGGAACACGTCGACCCGGGACGCCGAGGCGAGGCGGTGGAGGCTCCGTATTCA
GTGACACTACAAGGTGGCAAGGGCACAAGCGTTGGAGTTAGTCCGAGAGGCCGTCGAAGAGAGAGCGCGTCGACAAACTGAAAACGCGACGCGACATGAG
ACCGCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCGGGGTATGCGCGCAAACTCGCGCACATGTGGCACGGACCCTTCCGCGTCGCCG
AGCTGGTCAGCGCGTTCGCAGTGCGCCTCGAGACGACGGGTACGCCCTATCAGCTCTACCCCGTCGTCCACATCTTCCAAGCTGAAGTCCGTCCGGGAAT
TCCCGTCGCGACACGCGACGCAGCTGACGGTGCCGGCCGAGGAGCGCTTCGACTTCGACGAGGAGCTCTAGCCGGAGGATAGCTGGGAAGCCACGCGCGA
GCTGGAGGACGACGTCTTCGAGGTCGAGAAGATCGTGAATGTGCGCGAGGGGCGGGCTACCCGGTATGGCCGCACGCGACGCGAGTTCGAAGTCAAATGG
AAAGGCTACCCGGACACGACGTGGGTCGACGAGCTCGAAATGAATTGCGGCGGGTTGCTGTACGACTTCCTGCGCCAACGCACGGGACGCAACCGGTTCG
AGGCGATGCAGTCGCACGAGAACGCGGAGGCGGTGGAGCCTGGTGGGTGAGCGCCCGCGGGTGCGACGAAGTCGGCGGGGGGGGGCTGCCGACGGGAGGA
CTGGTGGGAAGCCTCGACTCTGGGAATGGCCGGAGCGAGGGATTGGCTGAGGGAAGTGAGGAGGATCAGCCTGTTGCTGAAGATGGGACGGCAGAGGGCC
GTCTCATAAAAGATGTGGAGAAGTGGAAGGAAACAAGGGAAAAGATCAAGGCTACGTGTTGAAGTTACGGCTACGACAACTAAAAGCGACGAACTACGAC
GATAAGCCAGGGGTCAAACCTGCTGGATGAACTTACCTGCAAGACGCGGCACATGGCAGGCTGGATGATCGCGCGTCACTTGGCAGCGTATGTAGGCGTC
CATCTCGGCCACAGTGAGCGGCGTCCGATAGACCCGGCGCCAGGGCTCCTGCGCGTCGATATCGTCGAGCGCGGCTTGCAACGTAGCGTGCTGGAGGCCT
GGATACCACAGTCCGATCGACGCGTGCGCGGGCGGAAAGTGAAGCACCATTGGGTCCAGCAAGAGGTCCATGTC