Description :
From Genome Similarity Track
Location :
Scaffold_16:338651- 346559
Transcript NameFunction/comments
Phyin_T30-4PITG_08689Putative uncharacterized protein

Sequence
7908 bases(100 bases per row)
CTACTCAGAAACAGAAAGGGGATCTCTTCGGTTGCTGCTTCAATCATGCACATTGCGAGAAAAAAACATATATCTGACGCGAAGGTTGGTCGGCTCGTTA
GCCACTCGGGTGCCGACCATCTAACTCCACCAAGCGTCAATTTATTCGGAGAGATCAGTGAACAGGATCGTAGCACGCTCAGACTAAAGTAACAGACCTT
CGCTGGTCCGTCAGTGCTGATGTGGATATATATCGCCTTTATATATCCGTGAACTATACCCTATTTGTTAATGGGATCCGAATCGAAGGCTGCTTCATAT
AACAGCCGCCACATGTGTCCCTTGTTACGATTGAGATACAACCTGAGGTTTCTGTTTGCCGCGTCTTTGTAGACAGCGAACGGCGGTGAAGTGACATGTG
AGGCCTTAAGCACTTTGACGATGTTCGGGTGGTAAAGCTTATGTCCTAAGCGGAACTCTATTTCTACCTTGAGCCGTATAAACGCGTCAATCTCGATGGC
CTCAACAAATAGGCGTTCAGCAACCACACGCGTATCTTATTCACACACTTCACGGTGTACCGACCCGGACCTAATGTGTAATGGGCCCAACTCCAATTAC
ATAAGTAGGTAGATATTTCTTGAGTTATTACATAAGTAGGCAAAGTGGCACACGGGTAGCGTGTGCCAAGGTACTGTATCATCATCCGATTGGTTGATAG
TACTTACCTATTGATCAATCAGGTGTAGAACTGTATTTGAGTGGTTCACACGAGGCCAGGGGTAGCCGCCCTGGTCCCAGATAAATCAGAGTTGAATTGA
CATAAACCTAAGACTTGGTTTTATTATTGCGAGCTTCCTCCACAATATAGTGTAAGCTAGTGACAGTAACGCTTACCCCGTTACACCTTGTAACACTTTG
TAGTCCTTCCAGCGACCAAGTCTACGATGAGCCAAGTCCAGATCTCCGAGGCAACCCTGGAGCACGCTGCATTCCCCTATCTCCCTCGTGTGAAGTGGGG
AGCGCTTCACCGCCTCGTGGCGGTGTCCGGAGATGCCATTGTCGCATCGCTGCTGCGTTCAGCGACGCCCGACCAGCAACGTCTTGCAGCACAAGCGTTA
ATGGAACGCGAGCTCGCCGATGTGAATCGGCAGCTGTCAACTCCCTCGCGTTCATCCCAGAATGACGTCGTCAAGTTAGAGACGTCTACGTATTCTGGCA
CCGGCGAAAACCGGCTCCCGCTTTAACCGGTGGTTCCGCGAGATCGCCATCGCTATCGCCTCGCGACTCATCGAGGCGTCATCACCCAAGGTACACTTCC
TCCTCTCCCGGTTAGCCGGGAAGGCCAAAGAATGGGCCCTTGGCAAGCTGGTTGTCCAGAGCGACTTGCGCCTCGCGTTCGAGCCCCGCAAGATGAGTCT
GGCGTTCGTGAAGAGTTCTTCGGCCTTCGTCAAGAGAAGATGTCCATGCGTGATTACGTTCAGAAGACGCGATATCTGGCCTCATGCATCGTGACCAAGC
CAGTCGACATGGCCTCGCAAGTCCACGTATTCGTGTTCGGCATGCGGGAGGGTATGACCCGTTATCACAGCTGGAGACATCGAGCAAGTGCGCTTGATCA
CCGAGGCAGTCTCGGTGGATGAGTCAGCAAACGCAGTCGCAACGGATAGTGAGCGTTCACGTCCGCAAAGTGCCGAACCTAAGTCTGCTCGTGAAGAACG
ATTCCAAACTCAGTCCTGGGAGGCCTGACGGGAGTCAGAGAATCCCTTATACGACACCGTTTGCGAGTTCGCCGACGTCTTCCCGGATGAGATCCCCGCC
GAGCTCCCGGCGGATCATGGGGTTCAACGAGATCGACCTTGCACCAGGTGCAAAGTACTGCGTCACCAGACAATGGCCACTTCCCCGTGATCAAGTGCAA
GCGATAGATGACTTCTTCGAGGGCCGCCGGAAGGCGGGTCACGTGCCCGATAGTACCTCGCCCCATTCAAGTCCAACATTCTGCGTAAAGGAAGATACAG
GGGATGGCGCGTTGTTCACGCATTCGACAAATTGAATGATGCCACCATCCCCGCGCAGACTCCGGAAGGACATGGTACTGGACGCCATGGCTGACAGCGT
CATCTACAACGCCATCGACCTGACCAATGGATTCGATCAAATCTTGATAAGTGCATGTGATGTGCCTCTCACCGCCGTAAGTACACGGAGCGGGATGATC
TGGGAATGGCTCGTGATGCCACAGGGTCTGAAGAACGCGCTTGTCATCTTCAATGGCATGGTCTCCCATGTGCTTCGTCCGCTCCGAGACTTCGCATCGA
ATTACTTTGACGACATCTTCGTGCACAGCCGCGCTGAGGGCAACCTCAGTGCCGTGGAAGTACATCTGAAACACCTGAGACAAGTCTTTCAGGAGATGCG
AGAGAACGAGCTCTACGCAAACCTGAAGAAATGTGTCTTCTGTGCACCGGAGATTCCGGTGTTGGGATGATACGTGAGCAAGAGCGGTGTGCGCGCAGAT
CCCGAGAAGGTCTCGTCTATCTATGTTTGGCCAACACCGACAAGCCCCACTGAGTTGCGTCAGTGGCTTGGCATGGCCAATTACGTGCACAAGTGCACGA
AGAATTACGCTGGGTTGATCCAACCGCTGTCCTCGCTGATGAAGAAGGACGTGATCTGAGAGTGGAAATTGGACCTCCAAACTGCATTCAACTCGGTGAA
AAAGAGCTTGGCGTCTGCGCCGATGTTGAAGCTTGCTGATGACTCGAAGTCATTCCACGTCGTCTGCGACGCGAGCTATTTTGCTATCGGCTGTGCGCTG
ATGCTGTCCGATGGTGACGAGCATGAACGCGTTATCAGCTATCAGTCGCGACAACTGAAGCCAGCCGAGAAGAACTACCCAGTCCACGACAAGGAGCTCC
TGGCAATGCGGAATTATCTATCAAATTCAGAGTGCACTTGCTCGGTGAGCAGTCGTTTGCGGTTTACACTGATCACACATCGCTGCGGGCAGCGATGGAG
AGTCCTCACTTGTCGCAACGGATGGCCCGTTGGATGTCCTTCTTTCCCGAGTACAACTTCGTTGTTCACTACAAGTCGGGCAAGAATAACATTATCGCCG
ACGCGCTATCTCGGCGCCCGGACTACGATCCCCGTGAGGCGCTAGGACATCAGGTGGCCGATGAGGACGACGACGAATTTGCGGTTTGCGTTTCGTCAGG
CATCAACCCGACGCTGATCACGCCCACGCTCCCGCTGGGCGACGCGCTCGTCTTGCGGGCCGCCTGGACCTGTTTGAGCGTGAGGTCGCGAGCCTGCATC
TGCGGGTGGACCGGCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTCTGCATGATCCGACGTATCGAGGCTCTGCTGCCACGTCCGGAGTCGCCTTCGGT
GCACTCCCAGTCGTACGCGTATGGTGCGTACCCGGCGTACTCAACGTACTCGGCGTATGGCTCCGGGATCCGTTCGTACGGGGCCCCTCCTGCGTACGGT
CTTGATCGCAGCTTTGCCGTTCAGACCGAAGCTTGGGTGCCTGCTCTTCGTCGACATCTGTGGCCGGTCCTCGCTTCAAGGAGCTGGGGCAATGTGGGTC
TGCGAGTCAGCAACCCCTGGGGATCAAAGTATCGCTTAATCGATCGCAACAGCGTACGATGATGACCCTATATACGGTGCCATTTTGAAACACCTGCGCG
CTCCTAGTAGCGACACGCTAAGTGCTCTGTCAAGGATCACGCGTAATCAGATCGATCGATATCGACTGGACGGCAATCTAATGAAGTACAGCATCGACAG
TTTCGATGGACCCCGAGTCGTCGTCCCAAACGACGCTGACCTACGTGCGCGTATTATCCACGAGTACCATGACGCCCCGACTGGACGACATCTCGGTTGC
GAGAAAACGTACGCGGTACTATCGAGAGACTTCTATTGTCCCTACATGTACAAGTGGGTAAGCAAGTGAGTCCGCACATGTGAAACTTGTCAGCGGGTCA
AACCGTCTCGACGTCCCAGGCTTCCGTGGCGCCCTCTTCCGGTCGCCACGGAAGCCTGGCGCTCCATTTCGATGGACTTCATCTTCGGTCTTCCGCCCGA
TACAGCCGGGCGCACGGGTGTACTTGTGTTCGTCGATCGTTCCAGCAAAATTGTCCATCTTGTTCCTGTGGCAGCCTTGATCACCGCGGAAGAGTCCGCG
GCTCACTTTGTCAAGGTGATTTCTCGTCACCACGGCCCGCCGGAGTCTATCGTATCCCGACCGTGACCCGCGGCTCACTTTGTCAAGGTGATTTTTCGTC
ACCACGGCCCGCCGGAGTCTGTCGTATCCCGACCGTGACGCGCGGCTTACATCCGCGTTCTGGTAACGCCTCTTCGAGCTCTTGGGAACTAAACTGCTGA
TATCGACCGCGGCTCATCCGGAGACGGATGGACAAACAGAACGCGTCAACCGAGTCCTTGAAGACGTTCTCCGCAGCTACGCGAATTCGTACACGAGCTG
GAGCTCGTTCCTGCCGTTAGCCGAATTCGCACTCAACAGCGCCGAGCACTCCTCGACGGGCCTGACGCCGTTCTTCGTGAACAAACGCCCGCCACCCACG
TGTCCCCGCACTTCTCGCCGTGGGACATCCCATGGATGCTGGCGGCTCCCACATTCGAGGTGGGAATGGCATTTCGGTGGTGGTGGGGGTGGGGGTCTCT
TTCGGTCAACATGGATGCTGAGGCGCGGTCAGTCCTGTAGTCAACGAGCCCGTGTCGTGGTCCCCACCGGTGCGTGAATCGGTGTCTCAGCGCGCACCGG
TAACCTCACCGGTGGCAACAGGCCTGCCGGCGAATTCGACTTCAGAGTTATCTTCAGGTGTAGCCAGTGTGAGCGCCTTGACCCGCTCCCCGTCCAAGCA
GACCACCGAGCCTCCGCGACGTACCACAGCTCCGATAACGAGATGGACATCGCAGAACTTGATTAATCCAGGCAGCAAGGCGCTCGAGCAGGACGTTACC
ACGACCAATTATACATCGAAACCCTTGGTGCTTCCAGCCGATCGCTCGGCAGCTGCATAATTCGTCAGGTAGAGACAATCCATCTCAAGGTTCGTCCGCA
ACGCACTGCAGAACGCAGTGGACAAGCAAAAGGAACAAGCAGCTAAGCACGGTCGAAAGAACGTGAATGTATTCAAGATAGGAGACCGCGTTCTCCTATC
GACCGAGGGAATCCGCGCTTCTGCCGTAGCCAACCTGGGCGCCAACAAACTTGCTCCACGCTTCATCGTCCCCTTTCGAGTAACCAAGGTTGTGGGTGAC
GCCTACACCCTGGACATCCCATCGTCACTTAGACTCCACCCGATCTTTTATGTCGGGCGACTCAAGCGGTATTTCCCTGCGACGTTTCCTGACCCAAGCA
GCGTGCGTCGGGCGACCAGCCCGACGAGACTGACGAGCCTGAGACCCGTCAGTCCGCCAGGCACGATCTTCCGCCCGTTCAGCTCCAATCTGAGCGGCCA
ACGCACGATTCGAAGCAGTCTTCACCTCGCCGTGGACGTACAGGGCGTACGTCGTATCACCGTGAAGGTCCACCACCGATAATTGACTCGGTGGACGACG
CGCGCTGGATTGTGGAGCGTATCGTTGGCCACGAAAATCCCCACAACTCGGCTGCTCAAGGTGACGTCCGCAGTCGTACGTTTCGCACGCCCCCGACGGC
GCGCCGCTATCTAGTACGTTTGATCGGTTATCCTCCGGAGCATGATACGTGGGAGCCCCGCGCCAACCTCCTCCGCGACGTTCCGGGCGTGGTCCACGAG
TACGAGACCAAGATGTTAGAGATGAAGAATTCCGCGGGTCACCCCGCCGAGACCAAGCTGCTAGAGAGGAAGAATTCCGCGGGTCACCTCGCCGAGACCA
TGAAAGAAATCGAGAACGCCCACGGTAACGGCCCATACGAGGAGGCGACAACGACGCCGTGCTCCGACGCGTGCAGCGTCGCGCGAGCCGCGGCGAACAC
TGACACAACTTGTCAGTGCAAGAATGAAAACACGAAACCACCGGCGACATCGAACCGGTGACCAGTGGGTTGCCAACCCGACACGATCCGACTGCGGCGA
AATGACTTCGATTACCAGCTCCGACACGGTGGTCAACAAGTACCTGCTTCTTGTTATACCAGTGGTGACAACGTGATGCTCACTTGGGTTGCTCAAGAGG
TTTACTTCCGTCGACAAGGCTCATGTCTTCGAGCAGTTCAAAGACGTTCCGCACTGGCAGCAAAACATCACTTACGTGTGCGTGAGTGAATCCGCCTGGT
GGGAATCTAACCCTGGTGTCCTGACTGGTAGCCACACGCATCGACTACTGCGTCACGAAGGCGCCTTCGTGAGTTTCCTCGTGTCCGTCATGCAACTGCC
TAAAGCTCGGAGTTTTCTAAGCCGCATGTGCGCTGACCGCTTCGTCGATGTGTGTCTTGGGAGCCGGAAGACGCAGTGCCGGGCCTCGCAGTACATCCAG
AGCTCGTGGCGCACCTGTCGATCATGGGCTTTCCCTTGTTACCACCACCAACGTCGCGCTGGCGCCGCCGCCCTTCGCGCTGTCTCCGATGTCTCCGCTC
CGTCGGTTTATGAGTCTTCTTCAGATGTGCTCCGTGCGCTTATATTGCGTAAACGCAACTTAGAGAGGAGGGTGATGTTATGGGCCCAACTCATATTACA
TAAGTAGGTAGATATTTCTTAAGTTATTAGTCGATCTTGATCGACGTGGGGTGTCGTTGTTCCTTAACGGGGGCTCATGCTCCTTTCCTTGCTAGACTTG
GTCGCTTCTTATAGCGGGGACGTTGAGGGTGAGAGTGAACACGATCGACCGGCCAAGCTGCAAACTCCGGCGACTGACACGTGTCCTTGGTAGACTTGAC
TTGGTTACTGTATGGACCACTACGATTTCCTGCTACAGTCCAAAGTTGAAGAACCCTTGTTGGGATGAGGCAAATTTCACTTTGTTAATACTTAAATTCT
TTGCGGTCCACTACCTGCGTATCCTATGATCATCAAACTGGCCCTTGAAGGTAATATCGTACTTATCCGATTTTAGTACAAATCAGTCAATCTACTGAGT
AGATCGTGTACCGAAATGACTGTGCCTTACCGATCCTATTTAGTTGATTGCGTATGCGCTCGCTCATGCGCCGTCGTCACTGGCGGCCTTCCAGCACCCG
ATTGGATCGTAGCCCATCAATCAGCTTCCAACTTAACCAACGGGTACTTCACCACAGTGGTAGGGGGTATCGACTGCTGAAATTCCATGCCATCCTCGAT
ATTTGTTAAGTTAAGTGCTGTAAACACGCTGGTCTCCTCGATTACTATGCACGTGAATACAGTGAGCCAGAAGGGGAAGGCTTTGTCATCGACGAGGTAG
CAGTAATGCTGTCGCGGTATGCGCTCGATCCGATGTCGGTGACGGAGCTTTCCACCAGATCAGAGTGTGTTCAACGACTTCATTGATGCAGCGTTCTGTG
GAATCGAAGTGGTGGATGTTCCCGCGAGTGATGAGTCGATGGGTGCCTGCGACGATTCTGGAGGCGAAGCAGAGAATAATAATGTAGAGCTCGATTTTTT
TCGGATAATAAGGAGCCTCGACACCTTTGTCAATCCAAACGTGAGATTGTAAGGCAAAATGGACTGAAGTAACTAAAGTAACAAACTAATTTTGGAAATA
TATTTGAAAAAGCGACTTTAGAGCAATGCAAATTTAGTGTAACGCTAACCACTTGGCTTTGAGCCAGTACCAGCGCCACAATGCCAAGCGAGGGCTTGCC
GCCCGAGCGCGGGTGCTAGACGCTTACACGAGCGGACGAGACTGGGCCCTGGTGGCGGACTGTAACTGCATTTCAGCCACTACAGGTACATGTACAGCCC
GCAAGATT