Description :
From Genome Similarity Track
Location :
Scaffold_138:33861- 42774
Transcript NameFunction/comments
g18578.t1hypothetical protein
g18579.t1XP_002896864.1 U3 small nucleolar RNA-associated protein, putative [Phytophthora infestans T30-4
g18580.t1hypothetical protein

Sequence
8913 bases(100 bases per row)
TTGGTCAGCCCAACTTCGTCCCGGCAAAGGCGGTAACCACCACGGAAGCCCAAGTATTCTACGAGTCCGTCGCCAACAAGTTCGAGACAGCGTTTGGACG
GACGCAACCGCAACTGGAAGTGCGGTTCTCGAACCTGTCGGTGGCTTGCAAAGTGGCTACGGTGCAGTCACCACAAAGCCAAGACGGCGACGTTGCCCCG
GAGCTACCAACAATTTGGAACTCGCTCAAGCATGCGACCGAAAACCTAATGTCAGCAAGGGAGAAGGAGCAGCGCGACATACTCAAGCAAGTGAGTGGCG
TGCTGCGTCCCGGGTCCATGACGTTGGTTCTCGGACAGCCAGGGTCGGGAAAGTCGACACTTCTCAAGGCGTTGAGTGGGCGATTGCGCGCGGACGGCGA
CCGTGTGAGTGTCACGGGCGAGATATCCTACAACGGAGAGCTCCAACAGCTCATTGCTAAGCAACTACCGCAACTGGCAGCATATGTGCCCCAAAACGAC
CAGCACTTTCCGCTCCTCTCGGTGCAGGAGACCTTGTCGTTTGCGCACGCGTTTAGTGCTGGCGGTGGCAACGATGCGGCAGTTATGATGCTCGGACACG
ACGCAGGACACGGCAGCCGACAGGCACTCAAATCTGCACTCGACATGTTTGAAAACTACCCTGAAGTCATCAAGGAGCAGCTAGGGTTGCAAAACTGTTG
GAACACCGTTGTCGGGGACAACATGGTGCGTGGAGTGTCGGGCGGAGAGAAGAAGCGCGTCACGACGGGTGAGATGGTGCTTGGTATGCAACGCGCTGTG
TTCATGGACGAAATCAGCACTGGACTCGACAGCGCTGCGACCTTCGACATCATCAGCACCCAGCGTACAATCGCGCGGACACTAGGCAAGATCATGGTCA
TTTCCCTGTTGCAGCCACCGCCGGATGTCTTCACACTCTTTGACGACATTATTCTCCTGAGCGAAGGAGATGTGATGTACTATGGACCATGTGAACGCGT
AGTGGAGTACTTCCGCGAATTAGGCCTCCACTGTCCTCCGAATCGGGACGTCGCTGATTTCTTGCTCGACCTTGGAACTCCTCAACAGTACGTCTATGAG
GCTCCACGCGGCAGTGGTGGATTGCGACCCCCTCGCCAAGCGAGGGAGTACGCGGAGGCGTTTCGACGTTCGGACACCCACCGGGATACCCTCGATGAGT
TGAAGGCGACTGCTACTCATGAAAGCCTGACTGAGAGGGGCAAAGACATCAAGTCGATTCCCGAGTTTCAACGTTCCGTGTGGACAAATATGCTCGCGCT
GTCGCTGCGGCAGCTCATGCTCATCACGCGCGACGTGAATACGATTCGTAGTCGCATTGTGCTCGTTCTTGTGGCGGCTTTTGTTTGCTCGACAGCCTTC
ATGAACGTGGATCCAACGAACATAGCGTTGGTGCTAGGCGTGATCTTCATGTCGGCGATGTTTCCGCTCTTCGAGCAAACGTCTCAGCTGTCCATGTTCA
TGAGCATGCGCGACATATTTTATAAGCAGCGATCGGCAAACTTTTTCCAGACGTTGGCGTATGTGCTCGCCAATGTAATCAGCCAGGTGCCGATCGCGCT
GCCTGAGAGCTCCATCTACGGCGCTTTCATATACTGGATCGCTGGGCTTGAGGCAAACGTTGGCATCTTCATCGTGTACGAGTTGATCATCTTTCTCACG
GTGATGGCGGCCGTTCTCATCTTCTTCTTCGTTACCGCGATATCTCCGAACATCTACATCGCAAATCCGTTGACGTTGGGGATTCTACAATTCGTGTTGG
TATTCGCGGGGTTTATCGTCACGAGAAGTCAAATCCCCGACTACCTCATCTGGCTGTACTGGATCGACCCCATGTCTTGGGCGTTCCGTGCAATCGCAGT
GAACCAGTACCGATCTGCAACGTTCGATGTGTGCACGTACGAGGAAGTCGACTATTGCGAACAGTTTGGTATGACCATGGGGGAGTATTATCTGAGCGTG
TACGATATCCCTTCCGAGAAGAAGTGGGTCGTGCTTGGAATTGTATATCTTGTCGGACTAATCGTCCTGTTCACCGCACTCAGTTATCTCGCGCTCGAGT
ACAAGAGATACGAAGGTGACTTCAGAGCAGTTCGGCCAGCGATGACCAACAGTGACGATCAATACCAACTCGTCACGACCCCCAGGCAAGGTCCTCGGGC
TCCAATATCCGGCCCACGCGATAGCGCTGTGATTGAAGTCCACAGGCACCCGAAGGCATTTGTACCGGTCACGGTAGCGTTCAAGGACTTGTGGTACTCC
GTTCCAAACCCAAGCAAATCGGCAGAAACAATCGACTTGCTGAAAGGGATCAGCGGAGTAGCACGACCAGGGACAATCACCGCACTAATGGGATCGTCGG
GCGCCGGCAAGACCACCCTCATGGACGTGATTGCAGGCCGCAAGAACACTGGGTCCATCCAAGGCAAGATCCTGCTAAACGGCCATGAAGCAACGGAGCT
CGCAATTCGGAGGTGCACCGGATACTGTGAGCAGACAGATATTCACTCGGAAACTGCAACATTCCGCGAGGCACTCACCTTCAGCGCATTCCTCCGCCAA
GGTAGCGACACGTCCGAGACAGCAAAACTCGAGTCTGTGAGTGAGATCATCGATTTGCTGGGCCTACACAACATTGCTGATCACATGGTGCGCGGGAGCT
CCTTGGAGCAGTTGAAGAGGTTGACGATCGGCGTGGAGCTGGCAGCCCAACCTAGTGTTTTGTTCCTCGACGAGCCGACAAGTGGCCTGGACGCGCGGTT
CGCCAAGATGATCATGCACGGGATCCGCAAGGTTGCGGACTCTGGACGCACAATCATCTGTACGATTCACCAACCGTCCTACGAAGTGTTCTCTGTCTTC
GACAACCTGCTCCTGCTCAAGCGAGGTGGTGAAACTGTGTTTTTCGGTGAGCTCGGCGAAGACTGCCAGGCTCTGGTGAACTACTTCGAAGCGATTCCTA
CTGTGCAGTCGCTGCCTACAGAATACAACCCTGCCACGTGGATGCTCGAATGCATAGGCGCCGGAGTCAACATCGCGTCGTCTGAAGGCGGAGGCGTGGA
TTTCGTTCAGTGTTTCAAGGAAAGCCCCCTCAAAGCGCGACTCGACGCGATTTTAGACGAAGAAGGCGTCGGATGTCCATCACTTGATGTCTCGCCCCTC
GAATTCCGTCGGAAGCGTGCGGCGTCATCGAAAGACCAATTCAAGTTCCTGCTCCGACGCTTTTTCAACATGTACTGGCGCTCTCCTGCACACAACATTA
CCATTCTCGGCGTGGCAACCGGCAGTGCGCTCGTACTGGGGCTTGTCGGCGTCGGTTTGTCTACGAGTTCGTACCAAGGAATATGCTCCGGTCTCGGCAT
CATCTTCGTCGCCTTCCAGTTCCAAGGGTTCGTGTCCTTTAACAGCGCGATCCCATTCGCTTTCGACGACCGCGCAGCCTTCTACCGTGAGCAATCCGCA
CATACGTACAGCGCGCTGTGGTACTTTGCAGCTGGAACGTTGGTGGAGATCCCGTACGTCTTCGTCAAGGGGCTCATCATCTCCGCGCTGCTCTTCCTCT
TCATGGGGTTCACGGGTTTTGGGACGTTCATTTTGTTCTGGCTCGCCATTTCATTGTCTGTCTTGGCGGACGTCTACACGGGGCAGTTTCTGGCCTTTGC
GTTACCGAACGTCATCATGGCGTCGCTCACTGGGTCAGTGGTGTCGACGGTCTTCTTCCTGTTCGTCGGGTTCAATCCACCAGGCAGCTCCGTGTCCGCC
GGCTACCAATGGCTGTACACGATCACTCCGCAGCGATACGCCATGTCCATCTTGGCCACACTCGTGTACGGCGATTGCTCCACGACCCCGCAGCTCGACT
CAGCGACGGGCAAGTACATGAACGTGGGCCTGGAAACGGGTTGCCAGCCGCTGGACGACGCCCCCGTCTCCATCGGGAACGTGACTGTGCAGATGCTGCT
GGAAGACGTGTACAACATGAGCCACGACGACATTGCGCGCAACTTCGGGGCGCTGTTGGTTTTCATAGCAGCAGTCCGAGCGCTGGGTCTGTTGGCGCTG
CAGTTCCTCAACCACCAGAAGCGGTAGATAGCTACACTTCAACTTCGACGTCACTAATCTGAATATTCACTTCAACTTGCTTTCGCTGTCACTAATAAGC
ATATTTGGTGTATTGTACATAACGTGCAAGCTCTCTTGCTGATAGCCAGCCATTTCAGTAATTGAAGACTAAAATGTCATCGCTACGCAACGTGGTAAAG
CGGCGCGAGCACAAGGAGCGCGGGCAGCTGCGTGAGCGGAGGAAGCTGGGGCTACTGGAGAAGCACAAGGACTATGTGAAGCGCGCGCGTGACTACAACC
GCAAGCAGAAGCGACTGCAGACGCTGAAGCTCAAGGCGGCGCTGCGCAACCCGGACGAATTCTACCACAAGATGGCGCAGACGCAGACGGACAAGGGCGT
GCACTCGTCCACGCACAACCACCTGCAGCAAATGGACTCGGAGGCGCTGCGCTCGCTCAAGACGCAGGACCTGGCCTACCTGCACATGAAGCGTGCCATG
GACCTGCGCAAGGCCGAGAAGCTCAACCGCGGCCTGCACTTTGTGGACGCGCCCAAGGACAACAAGCACACGGTGTTTGTGGACGATAGTGAACAGGTGG
ACACATTTGATGTGGCCAGCCACTTTGACACGGCCCCCGAGCTCGTGGACAGGGCCTTCAACCGCATCCGCAAGGCGGAGCTGCAGACTATTACTCTTCC
AGATTTGGCTGCGAACCCTAAGCAGAAGCACAAGATGCAGGTGGAGAAGGACGCCATGTACAGGGAACTGAAGGACAGACTCGACCGCGCCAACAAGATC
GGACAGATGAGCTCGAAACTGGATCTGGAACGCAAAGTGCAGGCAAAGGGCAAGAAGGTCAAGGTGAAAGACGGAGAGAACGGCATGCCCGCCATCTACC
GCTGGAAGCAACAGCGACAGAAGTAGAAGACGCTGACGGACGGTGATGGGCCCCTGTTGATTTCATACATGCATTGGTTTGGCAAGTTTTTGTTTTGCTT
TTGTTGAAGTTAGGCTGCTGGTGAATGTTGGTTGGATCGGCGACGAGGAACGTGGTGATGGCCGTACGCTTTACGGATTTGCAGTAACAGTTGCAAGATG
ATTTCTCGGTTGCCGGCGTAGATGGCGTTTGCTCGACGCAGCAGGTGGAGCGGCATCGTCTGAGCACACGTAGAAAATATGTAAGAGGGCTGGAAGCTGG
AAAACGGTGGATGGAGCATTGCGACCTACTTTCTTCTGCTGGAGGATGGCCAGCGCTTTCGAGATGTTGTGTAACGCACTAGCTTTGCTGAGCTGGTTCT
TGCCGGATGGTCGTGTGATGCCTGGGATGCTACGCATGAGCTCTACCTTTTCAACGATGCAGCACAGCAGCACTCCAGACTGGAACTCCGTCAGTTTTGC
CGATGAATCCTGGATATATCAAAGTGGATGTAAGTGCAAACGTGATGAGAAGCAGCTTACAAGATTGGTGTCGTACATGAAATGTGGAGGCTTTCTTGAG
ATGGATTCCCAAACGTTTCAGCCACGCCAAAATCTCCTCCACAGAAGTCTGTGACGGCACGAAGTTCTGATCTCCGTGAGTTTCAAGCTTTTTGGCCGGC
GAAGGCATCTCGGAGACACTATCGCTGGCTTGGGTCGGTGATTTCGCTGAGTCTGGATAAGCTGACATTGGAAAAGCCACTGCAGCTGTGCTAGTGTGTT
AGTGATACTGTCATGCGTTGCGCTCCAAGCACCAAACTCACCTGATAGTTCCTCAATTTCGATGCGTGGAGCCCTATTGTCCGATACCTGACTAGGACTT
GAGAGTGCATCCGTGTTTCGATTGTGTGAAGGAGCCGGCAAGATGTCGTCCATGTCTTGGTACTTCTCTTCAGTCTCGTGTTGACTCGGCGCAGAAACGG
AATCAACTGCAACGGTATAGACCGGACTGGAAAAGGGTGCTCTTGGTACTGGAAACACATCGTCGTCATCAAGGTTGCCGCTTGGGTCATTCGCGCTCCA
TTCAAGGCGACGAGCAAAACTATCGTGAAGTTTAACTTGAAATGACGCCTTCACCTTTCCCTGCTCGGCCAAGACAATGGCCGGGATATCTAGCAGAAAC
GGAGAAGATGTCATAGGAGGTGATGGTACAACTGCTGCTTGGACACCAACCGCACGAGTTTCGTCAAGACCTTTTGGTGAAGTCGTGGCACCTTCGACAT
GCGTTCTATGACTGGCCTGCCAAAGGTGCCACAAAATCCCATAGTTGATCTGTCGATCTCCAATGAGTACAGCTTGCTCAGCAGATGAAGTCAAGAAGCA
TGGCGGAATTTGCTCTTGTGGGAAGTTGCCAAGTTTTTTAAACGCTGTTGAAATGTTTTCTCTACGTGTATACAGTCATAAAAGCGGTGTTAGTAGGCCC
GGATGGTCGAAGTTGGCTCGAAGGAACCTACCTCATATCACTCAGAGTTCGGGGACGCTTGATATACGAAAACGACCTCTTTTGCAACACCTGAGTCAGT
AGCGAGCTGAAGCACCAATGCACGAGCAGCATCAGTCAGGCCAGAAATTCCAGTTTTATACTGTGAGTGCTGAAGTACCAGAACAATACACCGTTGCGCA
TCGGATCTTGCAGCACCCCACGACCAGAAGACTGCGTGATAAAAGAGTTACCTTCTTTAGACCTCGACACAGTAGACGCCGCAATAATACTCTGGCAATA
CCTTTTTCATGTCGAATCCGACACGAGTTAGCCACTCGTTCACAACGTGGATCTGCTCGCTTGTGACGTATGGCATGTTTCGCTTGAATGGAACGCATCC
AGGAGATATCACCTCTACTGTCGCGAGGTTCTGTCTTCTCAACTGAGGTGGCTTTGTGTGCTTAGGACTGGTTGCAGCCTCTTTTTCTGCATTGCTACCG
GTAGTCGTAGTTTTCTTATGCTTTATGTGAGCGCGGAGTGTTTCGGGGTGTGCATGTTGAGCGTTCGAGGGAGCAGCAGCATGTGCAACTCGTTCGACCC
GGTTGAAGACTTCGTCTAGTGCAGACCAAATCGTTTTAGACGGAACTGGCTTCGCTGGACGCTGCAAGTCTTCGAACGCGTTCATAGCTTCAGGCGAAAT
CCCCATTCTTTTGAATGCTGTAAGAGCTAGTGTCAGGTTACGTTGTCTCTCTGCAGGCGTCTGTGGTTCACTCACAGATGGGAACGTTTTGATACCCACT
TGATCAAATTGGTCTCCGCAGCGTTGAATGATCGCAGCAGCGATACGGCAAAGCAAGACCCCGCTCGCAAACACTTGCCGAATTTTTCTTGGTGAACACA
ATCTCGTTTGGTTGACGAAAATCTGGCTCATGGGGATCTCGATCTGTAACACAAGTTGAACCCAGTTGCATATGCGCACTGCCACCTCGCCATCACTGGG
AGGACAGCCGCTACATTTGCCGTCGAAGAGTTCGTCACGAGGTTGATACTTTGCAGTCGGATCCAGCATGCCATACACACGAAGGCCACTGTTATCGTGA
TAAATGCCAGTCTGCTTCGAGATAATCTTCTTGCTGCTGATGTTCGTCGAGCTTCCTACTGTCGTGGTGGAAGGAGAAACAGTGCTTTGTCTTCTCTTCG
GCACCGTCGCTGGCCTCTTTCTACTTCGTTTCGTTTCTCTCGTTCTGTTTAGAACAGGTCCTGCTTCCCGGATACATTTGGACAATTTTGTGGTGTTCAG
GTGCGTTTTGGGCTGAGGTCGTGAAGACGAATGAATTCGCTTGACCTTGCGTTCGCTCTCGGCATCCAGCTTGTCCTGTGGAGCGTTGTCGTGAGAGTGC
AACGAGAGCTTAAGCATCTCTTTGTGGACTTGTCGACGTCGAAGCGCGCCCTTTTCACTGGCAAGCGACTGTTGTTCCTTCCAGCGTTGAACTCCGAGAC
GCTTCAAAACAGTAAGCACTGCGCAAATTGCTTTGCTTTGACCTGCCAGAACTTGTGCTACACACTCAGCATTGTTCACAATGTGCATGGCGTCTTCGTC
TTGGCTTCGGCATTCTCTAGCAACAAACTGAACAACACGACGGAGCCGCTCCATGACCTCGCCATTCTCAAACACGTCGTCTTCTGTCAGGCCGTCCTCG
AAAATTGCCTCTGCGTCGTTGCGGCTCTGCTAGGGATTGAAAAATAAGCACAACACCAGCACCGAGCGTCAGCTTGAACAGCAGCTTGCACGGCGTGACT
ATACAGAGCACGTACTTGCAGCCACTCCACGATTTCGAGCAGCACGTCACCGAAGCGCAAGTCGCTCAATTCCTCGACCAACAAGCACTTGATGAGCGGC
AGTGAGTTTACCCAGTGCAGCAGCAACCGCGCATGCACGCAGTAACCAGCTTGTTCCCCTGCAGTCACGTCCAAAAGCTCCATCGATGGTCCTAAAGTCT
CACGCATTTGACTAACGTTTATGATCTTGAACAGTCACAGCTTGAAACTGCCACCACTTGCTTGGTCCGCCGTGGCAGGAAACACGCCCACAGGCACATC
TAAATGCTGCTCTCAAGCAGGAGACGGATTTGAGGATGCAGCACTACTCACTGTCAGCTGAATTCGCGTACGTCTTCTGTATGACGCCAGCTACCTTTTC
GCTTGGTCAGGCAAGTTGAAGCGGCATTCGGCTGTTGAGTCCACGCGTCAGACATGTCCGACGCAGGCTTGAGCCACTTTCGAGCATGAGCTTTGCTGTT
TGAAAAGTTTTGACCGCCAAGACTCTTGCCAAAGAGGCTGACGTGTTTGCCCGCAGCACTCACAAACCCCAGTCATAGACAGAGCGGAGAGGAACACCCG
TCGCGTCCATGAC