Description :
From Genome Similarity Track
Location :
Scaffold_12:3385- 4862
Transcript NameFunction/comments
g4902.t1hypothetical protein
g4903.t1hypothetical protein

Sequence
1477 bases(100 bases per row)
CCGCGATCGTTTGATGCGACAGGGTGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGAATTTCGTCAAGCGTTCTGGGAGTCTATCCACA
AGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGGCTCGGGTGCAAACAGCGTCGATCTCGAGCTGGCCCCCGGTGGCA
GACCATCCTCAAGCATTTACTGGCTGGGATGATCGCCGGACACTGCGATCTCGACCTGCTTCTGGATACCTTCTTCCTTTATTTTCCGCGCCAAAACGAA
CGGTGCTTTTGGTACCCCGGCCTCGGAGCCACGCGGGCACCCCCTGACTTGATCAACGCTCTTCCTACCGCAGATTCTGCCGACCCGTGGCGCAACCAAT
ATCGCACACAACTGAGCGATCATCCCGGGTCCCGCATCGCACGTCTAGACGGTAAGTTTCGGTCTGTCGTCGACTCGGAGTGAAGTCACCCTCTCCGAGG
TCTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACCCGACCCCGATCGGCATCTTTCTTCCCCGATCGCAAACTCAC
AATTCACAAATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCACTCTCCTCCTCCCCTACAGTGCCAGTTACTGCAGGGGGTCTTCCGCTT
CCCCTTCATGGGACTGCATTGCTTCGAATCTGTTCCGGCTGGCCAGTCCTCGTTCAAAATCGCGCAACATAGCACCGCAATTAAGGTCCGCCTCATCGAC
CCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGGTGGACTCGTCCGTAGCGCGTCCCGCGGCCGGTTCTTACATCCGCGATCTTCTCC
ACTTCAAACTCGCCTTCGTCGAGTGGGGTCTTCCAGCTGTCTGCCGGCAGGAGGGCTTCATCGAAGTCCAGACGATCGCTCTCGGTCACAAGCAATGACG
TGTCAGGACGATCAGGGAACCTCCGGACCAACTTCATTTTGGACACATGCACGATCGGGAAGATCCTATACTCCGAGCCCGCGACTTCAAGACGTGCGGC
GTGATCGTCGATCATCTCAGCGACACGAAAAGGTCCATGCCACAGATGTGCAAGCTTTCGTGCATACCCCTCCTTAACTCGGTCGAGGTGCAGCCATACC
TGAGCGCCCACCGCGATGTTGTGGGGCCGCAGATTTTCGTTGTGTCGGTTGGCTCTGCCTCTGATCGCCTCGCGCAGTCGCTCGTGAACCTGCTCCCGCG
CTTGCTGATAGTGTTCCTGTACGTGGTACCTCCATCGACGGGGCTCCTGATCGCGTCGGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCG
CGGGTCCTACCAGATCACGTCGCCCTGCAGGCCCGATCTCACGAACTGGAGCAAGAGTTGGATCGCGTGTACTCGTC