Description :
From Genome Similarity Track
Location :
Scaffold_699:3385- 4478
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_699-snap-gene-0.10Multi sex combs CG12058-PA

Sequence
1093 bases(100 bases per row)
AGTGCATGGGGAAGAGGGCTGTAGAGCGAAGCTTGGGCACAATGAGAACGGGACTAAAACGCGCGAGCATCACCACCCCTCCGGCTCTGAGCGTGTCGTT
TCGTGAGCTTCACTCCTTCTGATGCGGTGTGAAAGACAGAAGAAAGAGTCGTGAAGAGACACAAAAAAATAGACAAAATTGGATGTATCTGGAAAGAGAC
CAGTTGACGTTCAGTTGGTTTTCAGATCCTTAAAAAAACCTGGAGGCATTCTCATTGGATACCTGCAGCCCAAGCAACCGACCGTGAAACGCTAGATGCT
CAGGTCGCTTTCTGCCGCTTGGTTCCGCTCTGCGCCTCTTGCTGCGGCTGCTCCTGGTTGTTCTCAGCTTCATCTTCATCATTCCCATCGAAATGGATGT
GGCCGCCGCCAGTTTTCCGCTTCTTTTGCGCATCTCGGGGCTTGAGATCCAGCTCTGACTCGCCTTCTCGCGCTTCCTTCGTCTGGCGCTGGTCTAGTTT
CGTGCTTCTATCACTAGCAGCTTTGCCCTCAACCTGCTCTTCTCCTTGCAGCGCCGCGACTGCGAGCTGGTCCTTGAGCTGCTGCTTCATCTCCTGCCAC
CGCACTTTGGACATTGCGCGGAGGCCCTGGAGCTCTGGGTCCATCGCGAGTGCTGCCTTGATGGCATCTTCCGCTGCCTGGGCGGACGCGAACTCCACGA
ACGCAAAACCCTTGAACCGCTTGCTGTGCGGAAAGCGCGGCATGCTCACCAAGTTCACCTGCGAATGCAAAGAAATTGATTCGGAGAGTTAAAGGGATCA
CGCCGTCTGAAGTAGCAGACATCGATTGGAGCTCACCTTGCCGAACTTGGAGAGGCGTTTGCGCAGCGAATCGTGGTCGTCCTCCACTCCAAAGTTCTCG
ACGTACACTGTGCGCTCTGCTTACACGGAAGAAACGATCAGTGGGATGGTGTTACGGTTCTATACGAGCGTTATCGCCAATAAGCATGTGCGTGCGTGCA
CCTTGGCTGGTGTCGTCCTTGTCAAATGGCAGCTCGATCGGTGCGATTGCACCACGGTCTGCGCTGATGCGAATGAGAGACGACTTCTCCACC