Description :
From Genome Similarity Track
Location :
Scaffold_30:338424- 346191
Transcript NameFunction/comments
Physo_134182hypothetical protein
Physo_115890COG0124: Histidyl-tRNA synthetase
Physo_134183hypothetical protein
Physo_134184hypothetical protein

Sequence
7767 bases(100 bases per row)
CGATCGTACCTTTGGTTCGAGCACGTTGGGTCAAAGTTAACCACGACGTTCACCATCTGAACAGGATACCACTTCGTTGCCTGGTGGAGCGCACCATGAA
AGCATTGTTCATATGCCGCGCCACAAAATCCAGATCGGGCTTTTTGAGCACACTCATAGTTCCCAATGAGATTTTCCCAGTCCATAAAGCGTCCAATCCG
TTTGAATGCATATCCGCAGTCTACCTGGGTTAGCCAATGGCACACGTGCCAATAGTGGTCTTCATCGTTGGGGTCCAGAACGTAGTGCCGCCGAACTCGG
TCATATGACTCGCTCACTTGCAAACCAGCTTGATGCAGCGATTCCAAGTCAACCGATTGAGCATTTTCCACTATGCCACAGATGCTATCTATTCCGTTTT
TCACATCTTCGCGATGCTTGAGAAAATTACGGAGACTTCCACCACTATAGAAGTATTGTGCCTCCACAAGTTCTTTCACGGTTTTCTGTTGTTCGTGGCC
AAATCCCGTCGATCTTTTCCAGTCGTCCGGTTTCGATTCAGCATATTGAAGTAGATCACTGTGTTGCCATCCTGGTAGTACCACAGCGCAAGCTGAGTCG
TCAAAACAAATATCGTCTTCCATTGGAGACGCAATGAGTTGGAACGGGAGCAAGCCAAACAGATGGCCTGCTTCCTTTCTGGAATAGCCATCAATCAACA
CGAAAGCATCTTGAAATTCTTTCCTGTCAGGAAGCGAAGCAATTTTTGCAGACGTCAGATTCGCCATTCGAATGCACGAGCCCTTCGCACCATCAAGGTA
GACCACTGCACTCGCTTCTGAAAATCCCCGCAGACGTCGTACCACCAAAACTTTTTTCTTCTCGACAAGCGCCACATAAAGACTTACAAGCATAACAAAG
CACGATTTGCCGACACCCGCCGAGCCCACAAGCACAACCCGCTTCTCTCTTTTCGACAGAATCCGCATGACCAGCCCCCAAAGCACAAGTCCCTCCTGCC
GTACGAAGTAAGACGACGGAAAGCCACCGAATCCCTTGCAGAACTCGTGCAGGGTTTGTGTCGCAACAAATCCAGAGAAGACAAGCTGGGCCCCAGGCCC
AGCTTGTCTTTTCTGTCTCAATATATCAAACAGAAACTTCCACTCTTCAGCGGATACCCCGATTTTCTCCACCTCCCCAAATGACTGCTCCGACCGCTTC
CTCTTGCCAGCGATATCAGGCTCAACCTCTATCTCCGATGATTTCGACGGAGCTGGGACCAGAATGTGGACGGAGTTTGCGTCACGGCCCTTCAAAATTC
CAACCAATTGACTCATCGACGCCAAATGGCCTCTCGCCAGCAAGGATCGGGCTGGCCGCGCGTCGCCGTTCTCAATAGCCTGCACCTCGGCTGCAGAGAG
CCACTGGCCACTGTCATTCTTGGCCAGATACAGCCGCAGCTGAGCGGCGTTAAAGTCTCCAAAGATCTCCACGGCCTCGTTCTTGATCGTCTTCTGTAGC
TCCCAAACGCGATCGGTTCCCTTGACAGTCACTGGAAACGCCGTCCCGACCATCCCCACGATCAAGCACCACACCTCCATCTCCTCGGGCTCTGGTTCCT
GGCGGGCCAGCTCCAAGGGTTTATCTTCCTGCTCATGCTCGTGTTCCTCGTGCAGCTCCTGTTGCTGCCCGTCCTGGCGGAGCTCCTCGGCCGGGGGCTC
CTCCATCGTGTCCTTGTGTACCAAACTGGTTTGCATTTTCAAACGTTTCGCAGACCCGCGAAGAGAATAACCTCTTGGGCGATGTATGTCGAGCGCGCTA
GTCTTGATATTTGTATTCAAACCGTGCCATCGCCCGGTTTTTGTGCGATTATTATTCACAATAATTCCACGAAATAGACAATAGGATCGAGGTTTTTCAC
ATAGAAGTGGTCAAGCTCTATTGATGTCTATGCGGCCCTTCCTATGATGTTCTCAGAGAAACTCAAAGCTACCCAGCTCAACCAACGACACTTCCGCCTC
TTCTCGCTTCTCGAGATTCTTGACCTTCACACTCTGTTGCTCGATTTCCGCACCTCCCAGGATCACAGCATGGGTACTGCCGTAGCGTTCAGCAGCCTGC
AGCATTAAAGATGAACAACGAGGCGTTAGTCTACGTGAAGCGAGATGCACTTGTTGTCATACACAGAGCACAGCATTCGTTACCTTCATCTGCTTCTTCA
TATTCCCGCGACCATGGCAAAAGTGAACCGTCAGGCCACGCTGACGAAGCGTCTGCACAAATGAGACATAGAAGGTATGAGTGGAGACCGCCTTGCAAAG
CGTGTGGTCCAGTCGATCTGTTTACCTGAGCAACTAGCATGGCTTCGTGCAGCACTCGACTCGAATCATCGCCTGAAAGAACCGGAACAACCTGTGGAGC
ATTAATCGAAACAAGAAGTATCCTTAGACAACGAAAACAAATTTTCCAGCTTGGCGATGTGTAGATTGCGTACCGCGACTGAGATCGCAGTCTCGATTGG
CATCTCTCGAAGCAGGTTAAGCCGATCAACTCCAGCAGCCCAGCCCGCGCAAGCTGTCGCAGGCCCTCCTAACGACTCTGCGAGACCATCGTAGCAGCCA
CCAGCTAGCACTGCAATCCCTCCTGTTGTTGCTTCCACACTGCTAGAAGCTGCAGATGCGGGCTTTTCAACAAACTCAAAAACAGTGTTGCTGTAGTAAT
CCTGCCACCGTGAACGAAGACCAATCAGTACCTTTAACTAGCCTGAACTCGATCCAATGACACAAGAACGCACCAGCCCTCTCACGAGGCGAGGATTGTG
CTGGAAGGCAATGCTCAACGCATCCAGACCACCGAGAACTTGATCAAATCGCTGTGAAAATAAAACGTCAGCCGGATAGCATTAACAGCAACCGCAAACA
TAACCTCCTACCGTTCTGGATTCGTCGGAAAGAAAATCCTTAAGCTGAGGAGCGTCGATAATAATCTTTTGGTCGGCCTCACTCTTGGAGTCCAAAATTC
GGAGAACACTTCCTCGCTCGAGGCTAACCATTTCAAACGAACTCCGTTAGTAAGCACGCAACAGAGCGTCCAAGTCTAACTAACTCACCGCTTGATACTA
TCCGTGGATAGTTCGTCCTTAAACTTGGAAAAGAAAGCTTCTAGCGCCGCACGGTACCTTGAGCGGCTGCAGATATAACAAGACATCAGTTAAACATTAT
TATACCCTCTAAATGTATTGCGCTAAGTTGCTTGTCACCTTTCGTTGTCACCCAGAGAGTTAATCTCCAGTACGACCTTGTCCTTAATGCCCAAACTTTC
CAAGGCATCAGCAGCCATTGCGATGACCTGTATCGAGGTTCACCCGAGCTGCGTAAGATGATCATGAAGGAACCTGGCAAATGTGTTTATCCAGCATACC
TCGGTATCGACCGATGGGCCCGAAGAACCCACAAATTCCACGCCTAACCAACGTACAATGGAAACATTAGACCAAAGTCATAACCATAAAGATATGCTAC
AGAACATACCGAACTGCTGGAACTCTCGGTACCTTCCGCGCTGGGGACGTTCATATCTGCACCCAATCGAGCATTACCAGTCGGCGTTCAATAATAAACT
CAACTTCAACCAGGAAAGATACCCAAAGCACAACCCACCGGAACATGCTGCCCGAGTACGAGATTTTCTGCGGCAGCGAAAACAGCAAGTTGTTGCTCAC
AAGTGCACGCATAATACCTGCAACGTATTATACGCACGCACGAAAACCTTCAGCAACGACGCAGTACCAACGGACTCCCGTGCATCCAACCCGCACCGGC
AGTGCCTTCAGGTCGCAGCGTCACACTCTTGCCCGAGTTGTCCTTAAACGTGTACATCTCCTGCAATCGCAAACGTAGCAAATGACATGAATGTGTTAAT
ACCCAATCCATCGTCATCAAATGCAATACCGAGCAAGTTGTAGCCCACCTTCATGACGATGTCCGAGCCATCGCCCAGCGAGCGCGAGAACAAATCCGTG
TATTCCAGCAGCGGCGTCTGGATCTGCACGTAGTGTACATTGTCAGAGAGGAACGCGTCCGCCAAACCACGCACTGATCGGACGATTGACACGCACCGAG
CGGAATCCATAGCGCTCGACTGTGCGCTGCAGCACGTCAAGGACCTCGCGGTGCTGCTGCGAGTCGTCAGCCAGCAAGTCCCTGGTGCCTCTGACGCGAC
TGACGGCCTTCGGCTTGGCGGCCTCCGCGAGCCAGCGCCGCGTCCCGTTCGCCTGCACAGGCCTCGAGCACCGCAGCCGTAGCCCCAGCATCGTCAGCCT
CTCACTTCACTCGCCTTGTAAGTTGCGGCGTATTTTTGGCGAATCAAATCGCACTGCCCCATCTGCTGGTTGGTGTACGGACACTCGAGGCGACGCCAGA
AGCCTCGACGATGAACCAGGAGCAGCAGCAGCAGCAGGAGGCGGCCGACGCCGCGAGCCCGAGCAAGGCGCCGATCGCGCCCATTGACGCCAAACTCGTG
CGCCACACGCGTCGATGCAACGGCCGCGAAGTCTGCTCCTGCATGCTGCGCGTGGAGAGCGCCTACTTTCAGAAGAACCTGGTCGGAAAGGCAGCCGCCA
AGAAGCGCCGAGCGGACACCAAGGCTGCAGTGGTCGCTGCGGCGAGGCCCAAGACGCGCAAGAGCCAGAAAGTGACCAACATCCAGCAGCTCAACTACGA
GCTCAAGCTGCACATTGCTGCGTTCCTGCCGCCTATTGCGCTCGGTCGGTTGGGAATGGTGCGTGCTGCTGAAGGAAGGAGACTGCGAGATAGTCGTGTT
GCTGACGAGTGTGCTGTGGCCTGCTGAATGACAGGCAAACAAAGCTTTCCGGCACGACGTGGAGGTCATGGCCAAGCAGGCAACGGGGGAATTTATGGCT
GAAGCTGAGCAGGGCAAGCTGCTCAAGCAAGAGAAGCCCAAGGCGACTGAGTCGTGGTCACAATTCATGCACAACCAAATGACGTGTGTGCACAAGATCT
TCGTCTACTACACAGGCTACAAGACAGGAGCGATGAGACAGCAGTTCCCGCACTGGGCGTTTGGCACTATCTGTGTGGACCCGAACGAGCCGCATCGGAT
CATCCTGCCGAACACGTGGACATTTCATGGTCATAACCCATGGCTTCAGCGGCGCGGGAACGGAAAAGACGGCGAGTGGCTGTTGACGAAGAAGTACGCG
GCGGATAAAGCTCCAAAGGACTTCTTGGAGCACGTCAAAACGTGGGCAAGCTCCTTACGGCCAGGCTCGATGCTAGCAATCGCAGTAGGTTACAATTATG
CTTGCACGAGCAGAATCCAAGCACGGGGACTAATTTGGTGGCGGCGGATTGCTCAATTGTCTGCGTACAGTATCAGAATGTTGGATCACAGGAACCAGCG
TGGTGGGAGGCGCAAGCGTGGTATATATGGCGGGGTGACGGCAAGCAATGTAAGTATGATATATTTTGGCTGAGCTCTTGAGAGACGGGATCGCAGCTAA
CAGTTCCGTTTAATTAAACGTTGACGGCAGACCCTGCAATCGTGTACGATCCTGAGACGGATACCCGCACAGAAATCCACCCCGACGATCTGGTTGAGCA
CTTCAGGGTGAGCTTTTTCCTGTGCGATAGCGAAAACAGGGACGCGACTAACAGCCAGAATGGTTATGATGTTCCCGTTGGTATAGACACACCCGTTGCA
CGTGATCGACGTGTCAACCAAACCCGGCGCACTATGCCGACGGTGCACCATTCAGAACAGGACGTTCAAATACTGTCACGTGGACAAAGGCCACCCCATG
CTGTAGCCTTGTTCCCAGTTCGTGCTTCCTGTCCCGCTGAGAAGTAAAACTAGCGACAGATAGTAGATGAGCAGAACAAGTTTCACTTTGTGTAAGCTTC
ACCTTGACCGCTTCATTGATTCTCAGGTTCATGCTTTCGACCTCATGTTCATCCTATCAAAAATAAAAAAATAAAAAGCTGTTCCTACCACAGGTTTACA
CCGCGATGACAGGCTGTCTACGAGGTCCTGTGAGCTTGGACAGACCTGCCTTGAATAGACTCCTCTTTTCCTTGGCGTTGCCACGTCGGAAGCGCAGCAC
AAGTGGGCGCTTCGCATCGTTCAGCGCCCACAGCGTGTGCTTCAGACCCGCGTGCTCGATGTTCGCGTTGCCAATCGCAACAAGGCAATCGCCCGGGTTC
ACAGCTGCAGCTTGGCCCTGACTACGTCGCACAATGAGACGCGGCGATCTCTTGGAGCCGTCAAGCTTGGGCGCCTATACGCACGAACAAGTAGAATCAG
TGAGACGACTAAATTGGTGCTAACAAAAACACAATTCGCGAAAATCGTACCAGCTGAAGTCCAAGAGGGCCCTTGCGACTAATGGAAATCTCATACTCGT
TAGCCTTGGCAGTCCTCAGTGTCGAAACACTAACGACTCCCATTGCCACAATCTTGTACACACCCGTGATACTCGTGACGGCTGGGTGCTCGGCGACTTC
GTGGGTAGTAATCGTCTCATCAGCTGAAAACTCAGCTTCTTCTCCTTCATATTCCTCCTCCACAGTGGCTTCACACACGCTTTCAGTGATCTCCCGAGCT
CGGCTGTACAAGCAACATACATTAAAACGTCAGATCTAATAGCACACCAGCGCCCGCACGTAGCGATTTTATAATACGTACGTAGTAGATCCTCTCCGAA
CAACCGTTGAAGGTTTATCCGACTTCGGTGCTGGCCTAGTAAGCGAGATCATACCGTTTCGTTAGAACAAATTTTGATACACCAAGCTATTGCGCACATC
ACTGCTTACCTGGCAGAGCTCGACAGTTTCTTGGACTTCTTCGACGACCGTGAGCTCTTAAGTTCTTTCAGAACCAAGTTGTTGACACTTCCCATCGAGA
CAGTGGTTCCCGTGTCAAGGTTCTTGACGCACAAGTTGCTTTCAGCCACCGAGGTTGGCAGCTGAATTGGCGTCGGCTCGTATTTCTCGTAAACGATACG
ATACAGTGATGGTCGGTCCAGTGTCTCTACGTCCAGCGTAATTGTGCCCACATCGCCAGGAGGGATGCTGAAAGTCTTGGACACTTGAAGCCACAGTGCC
ACATCGGAGTTCATGTCGACCACGCGGATGCGGTCAAGCGGACTGTGACCAGGAGGGGCCTGGAACGTAATCTTGAGGGGCTTGCCAAGATCGCAGTTCT
ACAGCAGAAGAGAAATATAAAAATTTGTAAGTGCTTTTGCAGATGCATGAATCAATCACAGCTATTTGCCGCCCGCATACCGATTTGCACTTGACACTGT
AGCCCGTCTTCTCCGCCTGGCGACGGAAGAAGGCCCAGGCTGCACAAACATTTTGCTCGTGCTGCAGCTGCTCCGTGTGCTGCAGCAGGCTTTTCGCACG
TGCCACCTTGGGGATGTTGAAGTCTTCGGGGCCGTATCCGTACGGGTTGAACTCGACGCGAGCTCCACGTCGAATGAGTTCCGCAGCCACATCATCGGCT
CCGCTAGCACTGATCGTAAGTCAAATCGCACACGGCGCAACAATTAGTACACAAACATAGCGATCCAAGAACTATCTACGTAGCACATACCAAGCATAAT
GCAGACAGCTCCAGCCTAGCTGGTCCTTGTGGTTCATATCACATCCGGCGTCCAGCAGAATAATCGCAATGTGCAGACGAGCATCGGTGTCGCACTTGCT
GGCCAGCATGACGAGGTTGCGCTGGCGGTTGTCCAGGTACTGCACCTGCACTCCACGCTCAATGGCG