Description :
From Genome Similarity Track
Location :
Scaffold_10:338374- 344843
Transcript NameFunction/comments
Phyin_T30-4PITG_06759Putative uncharacterized protein
Phyin_T30-4PITG_06760Putative uncharacterized protein
Phyin_T30-4PITG_06761Putative uncharacterized protein
Phyin_T30-4PITG_06762Putative uncharacterized protein

Sequence
6469 bases(100 bases per row)
TTCCACGCGAACTTTCGTCTTCTGCTCCACCACTTTGGTATGCAAGGGTTGCACATTCTCCGTTTTACCTCCCGCGGCTTCCTCCAGTCTTCGTCTGTAC
GCTGCCTTATTAACTCTCCCCATAGTCGGCGCATGTCGACGTTGCAGTCTCTGCTTCCTCTTCTCCAGCATTCTGGCTGTGTCGTCGTCTAGCGAGCCAA
TGTCGTCGATCCGTTCCAATGGCGTCATATTGTTGATCTCTTCCTCTCGGGCTAGCAGTCGATCCTGCTCTTCTTTGATCATCCGCGCCTTCTTCTCCTT
CCACTTGCGGATCTGTTCCTCTCGTTCTTGTTGCAGTCTCTTCTCCTCCTTCTTGACACGATGTCGCTCGCGTCGAACCTCCTCCCCCGCTGCACTTTGA
GGGTCCAGTACAGCCATAAACCCTCGACACCATTTCTCCAGGTCCACGCGGTTAAAAGCTGCCAGATGCATCCGCGACTTGGCGTTGCGCTCTACTTTAA
GCTCCAGTCCGTACGAGTCTACTTTAAGTAGACCGTCTCCGTCCCAGCCACCGAAGCCTTGCAGATAGGCAGAGTCTACCTTGCTGCGTGTCTCGATGTC
GCTGCCGTCGAAGAACTCAAGCTTGCGGTTCATTGTGAGCACTACGTAGAGCTCTTTGAGGGTCTTGCTGCTGATGGTTGGCTTCCAATTGGGAGGCTTC
GTGCCTCCACTGCGTGGGGATGCAGGATCATCGCGCTTGCAGAGCAGGAAGCCCTCCTGCACGACCCAGGACCCACCTCCCATGGTCTGGTCCGAGGAGC
TTTTTGTATGGAATTTCTGGGTATGAAGACAGTCGCAGAGAAGAGGAGCTGTCCGACAAAACGTGTCTCCTTTTGACCTGGATTTTTAAAAGCATCAAGT
GAGAAGACAAGTGTGTAATGAGACAGTATCCGGACACAAAGGTGCATGCGACATCCGTATTTTTTGAACTGATGATGCACTCCAAGGGTCGGAACTACAT
GTACATGTAGCTACACGCCGTGTAGCAGCGACTGCGCTTGGCTGAGCTCCTCGTACAGCGCCAGAAATTTGTTCTTGCTCATGTCTAAGCGGAGCTCACA
GCTTTCGGGTGCAGCAGTTGTCGCCACGTTGCATTCCACCACCGGCTGGTCCAGCTTCAAGTTCAAAATCACTTTGGACGGGTCCTTCTCCACCTTCCAC
TCAATCTTCTCGACGCCAGGAAACTGTGGGAGTATAACAACACACAAGAGAGTCTGATATCAGCATACAGTAGTAAATATGGATAGGAATATTCAAACCT
GAAAGCGTCGGGCACGTTGCTGGTCTTGGATGTGGACGCGAAGATCCTCGTAGCTCTGCGCAATGGTCTCCGCAGTCTCTTGTTGCATGCCTAGCTGTTG
CAACTCCTCCACCAGATCTATGCGGTTGACATCGTACTTGGCAGCGTGTATCAAGATGAATTGTAGCACAGCAACTGCAGCCTGCAAGGATACTCGAAGC
GTCAGGATCCCAATCCCCGCCGGAGTAAGGGTTCAAAACTCATTGACCTTGGCATCTGCAGCGTCCTCAAACAGCTTTTGTGTCTGATCCAGCTCCTGTA
GATACGAAGGCAGCACTGCTAAGCTCTTTGATCCACTTTCCGACTCATAGCAAGCAACATCTCAACGGACCTGCACTTCGATATCGACCCCAATTGCTGC
ACACATCGCAGCCAGATCGTTCTTCGTCTGAGGATTAGCGCCAACAGCAGCATAGCACATTAATCAGCGCATCAATTTACTATTATTACTGTACGCTAAT
CAAAACCAATGACGCACCACTTTGCTGTGCTCGCCCGACAGCAACAACAGCTCGGCCAGCAGCCAGTCAGGCGGCTCCAGGCCTCCGCAGAACCGGAATT
TCTGCACCAGATGCACAACGCGTAAGTGCTGCGCATAGTCTTTCCCTTGTATACTGTGTCAATGGGGTCTAATAGTACGCAGACCAGCGCGCATCTTGGT
GATCATCACACCACGCACCATTTTTCTCGCTTGCAGAAATACTCAGATCTGAGCCTAAATCTCTCATCTCAAAAGGTCGCAAAGGAATTCTGAAAACGAC
AGTTGCTGACGGTCTCATTGTGGCGCATGCATAATGGCGGTGGCAGCGCTGTCTGCACCGAAGCATCGTAAGGACGCAGAGGGCGACAATAACAGCGCAG
ACAGCTTCGCCTTGCTGCTCGTGCAGGAGTGGCTGGTGGCCTGCAAACTCGCTGCCACGGCGCAATGTCTTGTGGACGAATGCGCACGATCAGAGCGAGA
TATTCCAACAAAAATGCTGTGGAAGCGAATGGTGGAGAATTTGGGTTTCGGTCCACGGAGCCCAGCGACCGGAGGGAAACGTAGCAGTGGCAGTACGACA
TTGCTCGAAGCTTTGATCAGGCGAGTAACTGAACAGCACGAGAAAGAAATAGCACAGACGCTTCGAAACCAGGCCATGGTCCCACAGCAGCAGGTTGTGG
TCATGAGCAAGAAGAGAGAATTAAAATTTGTTCACAAAAGGTCTTTGCCGAGATTCAACAATAATGACTCGGAAAGAACACCCGAGCTATCGACTTCATC
GTCTTCCGTTGGACTCCGACCAAAGTCTGCGATGGTCTACAAGAGCACATCCGATCTATCGAAAGCGTCAAGTGGTGACTCACTCAATAATAGCGGCGCG
AAGGCTTCGATGTCGCCTGGTACGGTCTCCTTGGTGAAGAAGAAAAATACCTCGAGTAAGAGACCCATCAGCGCTGCTAGCGTGTTCACAACACACAGAG
ACTCTGTGATGAAGAAGAATAGTGTTGCGATAATTAAAACTCCACCATCGCGCTCACCGACGTGTAATTTTGGTCAACATGTCGTGATAGAATCAGTAGA
TGAAGCGATGAAACCACTTGCCCACCACCACAACTCAACGGTGGGGATACGTGCAAGTTTGCCTCGTATCACGGAAGATACTGGACCAGCAATTGAGGAA
GACGATGAAGGTAAAGAAAGCCCTTTGCAGGACGAAGACGAAGCGCCTTCTCAACTAGCACCAACGTTATCCCTCGAGGAAATGAGCGAGGAACGTCTCA
CGGAGCAATTTGGATCGCTCTCGCGCTGTGCCATCAAGAAGCTGCGTCGTGTATTGGCAAAGTCGCACGCGTACTCACAGGAGTTTGAAAAGTCCCAGCG
TACAGTGGACAAGATCAAGGCACGCGCTAAGCTGCGTCAATTGCGTCGCGTGCTTGCGGAAGAGCAGACACCTTTATTAACTAGTACTATGGCTCCTCTC
ACAAGTGAACCGTGTTCCCTCTGCTTATACGTGTTCCCGAAGAAGAACCTCATGACAAAAGTATCCTACAAAAGCATTGTCGATCTACGAGCGTCCTGGG
CAGCAGCAAGCGGAGCAACAACCAGTGAGGAGGCCGCGCAGCAAGCTGCGGAGGGGATGACTCACGCGCGGATGACGCATTTGTACGACGAGGCTCCAGT
TTGCGCATTTTGCTCGCAGCTAGTACTGAACTCCTCTTCGTATCGGGTACGTTTGCTGCATATTAAGTTAATATTATTGTCGCCTTACACAGCGGCGTGT
AAGTGCAGCCCTCATCGGCAGATCGTCGAGCACAGCATACCAGGGAGCGACACGAGGGCCTCGAGATCTTAAAGGAACTCGAAGCGAAGAAGCGACGTGA
TCTCGAGAAATGCGACCCGCTCGACTACCACAACTTCGAACTAAACAGCGATGACGGCGGCGACAGCGATGTTGAAGAGGTCGTGGAGTTGGGAACGGAC
GGCCGTCGGCAGGTTGTTCGCCGACGTCGTCGACAGACGATGCGCGCACCCGTGCAGCTCGGTGTGGTGTCCAAACGCCTGCACTACGATCACTTACGCA
GCGACTCGCTCCACATGCTCACATTGAACGAGTGGCAGAACATCACGCGCTGAATCAATGAAATTCCACATGACCCAACAGCAACATCAGCAGACTGTTA
GTGAAAGTCATCTGCTGCATGGTAGTGGCCAGGGGTATTAAATGATTTTGAAGGACAACCAGATTATCGATGGGAAATCAATGCCATCGGAAGGGTCTGC
ATTACAACAATGCCAATACCGGTACATGTACCGGTAACTTCAACACATTTCGCAATTCCAGGATCGCCACAAATTGGGAGTAAAATTTGGGCCCGCTGAC
GATTTGCATCGTTTAGCATCGGAAGGCTTCACCTCCGTCTGCATTACAACAATGCCAATACCGGTACATGTACCGGTAACTTCAACACATTTCGCAATTC
CAGGATCGCCACAAATTGGGAGTAAAATTTGGGCCCACTGACGATTTGCGAGAATCAGTATGAGATGGCTGCGCAAGTACGTGGCCTAGGACAAAAAGTC
ACCGCGCCTAAGGCAAAATTGCCACAGTGCTGGCGAACGTATACACTGTTCTCCTTCTCCGGTCTTTGCTATCTATAAGATCCTGTACGAAAGAAGTCAA
GCGCTTTTAATAAAATGCGCCAAGGCTAGGTGCATCTTCGGAGTTGAAGCGTGGACAGCTGTGCCAGCGCTTTCCTTTACGTTTCGCTCCCAAAGATTTG
ACTAGAAACCCATAAGGCTTTATTTTTGCTTCCATTTGTTATGCGGATGTGCGTCCAAACGGTGCAGTTTTCCTCAAACAAGATTTCTAAAAACTGGTCA
GTCAAAGGCTAAACCGCGCCGAGGGCAAAAAGGATTTGTGTGGCGATGCAATGCGCTTCGTGGTATTATATTACAAAACGTAATGCTGCGCAACTCTCAT
TCCGAAGCTGTTAGACAAACTATTACGTAGTATTACTTGCGTTAAGTAATACATGTAAGTACATTTGCATTTGAGGAATGCAGTATTAGAACCCCAATTT
AATGCTAGTGTGACCGTTTTTTTTAGGGCTCTCACTGAACCAGCTGTACCCATTTCTACCATTCCCCCATTTCCCGTTCCGCGCTACTGCTGATTGAAAC
ACAACCTCAAACGTCCAGTCCTACACAGGTGAGCAGCTCAGATGGTCGCGACCGACAGCGCAGTGAAGCCGAAGCGCTCTAGCTTCGTGCTAGGTGGGTT
CCTGCCCAAGGTGCCTACCTACCGTAAGGAGAAGAAGGATCCCAGTAGCGTCGTTCTTGATCAGGAGGCCGAGGAGGAGCCTGTGCTCGACGATAATCAG
GTTGAGGACCAGCCCAGTAAGTTACCGGATTTCCCTGGCGAGCGCCGCTCTCACGACGGCGTGGTGCCCGCTCCGTCCGCCGCATCTGTAGCGGCCGCCG
CTATCCGTCGCCGTGGCATGTCCATCGAGCAGACGGCAACGTCACTCTACCGCCGCATGAGTGTGCGCCAGAACTCCGCCCCCGAGCCGGCAGAGACTGC
CAAGCCGTCGCCAACAGGCAGTGACGAGAGATCACCGTCGCCTCAGACGGACACTGTGCTCACGGTACGACGTGGCATGTGCGTGGCCACGACGTTCGGC
ACGGGCGCCGTGCTGGACGTGCGAAACGATGACGGCTTCGTCGTGGTGCAGCTGGTGCCCAAGAGCATCGCGTACCTGCGTGAGGAAACTATTATCAGGG
AAATTAAGAGTGTGGTAGGCGAGAGAGTCAAGACTCGCTGGGGTATGGCCACTGTCGAGCAGTACTACGTCGAGGAGGACATGTACAGCATCGCTTTGGA
CTGGCGTTGGGACGATGAGCACGTGTGGCGCATGAAAGCGACAACCAAGAAGTTCGAGAAGATCCACCCGCGTGGAACACTCATCCAGAACACCAAGAAC
CGCTTGTTCGAAGGCTACAGCTCGCTGCGGGAAAGCGTCGGGTCCAAGCTCATCACCAGCAAGAGGTAGAGGCGTGCATTGCTGATTTTTGCTGCTAGAG
GGTTTTATATATTGTTAGAGACCGTTTCCGGGATGGGTTTCTCATAGTGTTTCGTTTGTTGTGTGTCCTTTCACGCTGGTGCGTATGGTGAGACAGCGTG
GCAGTTAACACCAAGCATGACGCGGTGGAGCAGCCGGATCTGGGCAAGGCGCAGACGCCTTTCGGTGTCTGTACGGTGCTGAAGGTGCGCACGGACAAGT
TCTTTGTGGTCAAGACGCCAATCGGTGCCACAGCGTACCTGAACGCGGATTCGGTGCGGATGCTGGGACGACGGACGCATTTCGTCAGTGGAGACCGCGT
CAACACGCCCTACGGAGCAGGTCACATTGCACACTTCCGCGAGGAGGATGAGACGTATGCTGTGGAGCTGGAGGCGCCGTCAAGTGCCGGCCAACTGCCG
TTGCTGTTCATTAGCGACGTGCATGCCGAGACAGACTTGACGTACGCACCAGTGGCTACGCGCCTGTCCTCGATTCTGAACATCACACGCACGTCCATGA
TGAACGCCGGTGAGAGAATGCGCAGCGCTTCGGTTGCTGCTGGAGGCCTCCCCACGCTCCCGGCTAACC