Description :
From Genome Similarity Track
Location :
Scaffold_60:33836- 35531
Sequence
1695 bases(100 bases per row)
ATTCTGATGTTCGGAACAATAAATGAAAAATGACTAGGTCAGTGGCTCGCGCCAAGAGCGCTTTTGTTGTCTAGCAAAGGTTGGTTCATGATTCTCTCTC
ACTAGAAACATTGCGCATTGCGTTCAAGATCTTGGACCTTCAATCAATCCATAGATCGTGGCGCTCGAGCTAAACTCTACCAAGAATATGATCATATCTC
GAGTCCAAATCTAGGACAAGACAGCGTTCTATGCCGCCAAAGTCTAAAATTCTTACACCTAAGTTCAGCGAAACTTTAGGAACGGTGGCGTGGCACCCAG
TTGCTTGACGGACCGTGGTAACATCACCTTCGTGTGCTTTCAGCGCTTCAGCATTCCGCTGACTCTCTTCAAGGGAACGGCGTTGGACGTAGTTGCCCGA
TTCCCCATAGTCGATCAAAATTGACCACGGCTTCTAAAATCCCTTCACCGTTGCCGAGGCAACCAACAAGCGTGGCTTGTATTCACGTTTCGTGGCAACG
TCCACGAGATCTGGTGGGGCTAATCCCTGATCAGATCTACCTCCTAGAGCATCTATAAAGCCTAGTTTCTCCTCAGTAGGGCGTCCCGCGCCTTCTGGGA
GTCGCCGTTTCCCCGCACCGTACCAGATTTCTGGTTTGGAGTGGTATTACGGCTCGGCTGATTCTGTCACGGTTTACGCAATGGACAGTTGGGGTGGAGG
TGCCTTGTGCTTCCGCACGTGTAACATCTACGGATGTTACGTTGCTGTTCCACAGCTTGAAGCTCTGCTTCGTCATTGTCCGCATGACTGAGATCCGCGG
GATCTGCCCTATCAAACGAAGATCGGGCGTGCCCATGCGTACCATAGCGAGCCGCTTTGAAATTAAACTCGGCGTTCAACGCTATGTCCACACCCTACTC
AAAGGTTATGGGGTGGACACGAAAAACTTCGGTCCGAACGACACCAGTACGGTGACCTTCCATAAAAATGTTGACACGGACTTCCTCAGAAACGAGATCA
AGTTGCAATGCAGCAAGAAGAGTTCCCAACCCTTGGACATAGTCCGATAAATACGTCCTCCCTTTTCGGGAGGATAAGAAGCGTGAACGCACTCGATAAG
CCTGAGTAGGCAGTGCGAACAAGCGGTACATCTTTTTCTGAAGCGAATCTCACGTAGGAAACGCGGCGTCTACAGACGCATCACACGTCCAAGCCCATTC
TATGGCTCTGCCGCCAAGTTTTGATATGGCCAGGCCAGCCCTCTGCTGCTCGGTTTGCAGCATAGCGGCACCCATCGCCATTTCGACTTCTCGAATCGAG
AGAAGGAAATTTACTCTCGCTTTCCTTTCGATGGTCTTTAGTCTCCAAATGGGCGGCCAGACTTAGGCTCCTCATCGGATATAGGGATGTAGCGTGTTGG
CATAGGCGACGCTGTCTGGTCATGGACCTGTCCGATTAAGGTGGCCTCAAATTGCACTAAGGCTTCCATCCGCGCATTGAGCACTTCTGGGCTTTGGGCC
ACAATATGATCGATCTTTTTCAAGCCCAATCAACGCTCTAAGCTTATCAAGTGCGATGAGTTGCACCTAAAAGAGATCGGGTAGACTCTCCATTTCAATA
AAGGATTAGATGTTTTACGACTACGGCATAGGATTGACTACAAATGCTAGCAAGTGTAGTGGAGTTACACAGCTTTTAGTCAGAGGAAGACTTAC