Description :
From Genome Similarity Track
Location :
Scaffold_227:33813- 36449
Transcript NameFunction/comments
Phypl_g5620hypothetical protein

Sequence
2636 bases(100 bases per row)
TTATTGCGGTTTTTCCTGAGCGAGGCGAGTTCGTTCCTAGTGACTACGAGGTAGTCCGAAGGCGCGGGGTTCCTGCGAATATCAATACGGTAAGGCACGG
TGTCCAAAAGTATCATCAGCGCGGTCCAAATCTAAATTGTGCTATGTTTTGGGGTATCATAGGGAACGCAAGGGGAGAAAATCTACCTTTGCTTCAAGCG
ATCCGCTACGTCAGCGATCGTTGATTTGGTAGTGCTTTTCCCGAGGAAAAATGAAACTCTTCCATATGGGTAAGGTTGAGTGGATAGTAAAATAAGCCAA
ACTGTTGATTGACTGAGCTAACACAGCAAATGTGCTCAGCTACATGAAGGTGGATAAATCACCGCTTGGCCACGTTGCGGATCTCAATTCGACTTCAGGT
GGCACCGACGTTTTTCTCGGCTACAAGAAAAAGGTATACGATATCATCTCGGAGCATTTTGCAGCTTGGCCTGACTGACGTTCGCTTGTGTGCGCAGGTG
GCTAACATTAGTGAATTGCACAAGATGTGGCTTTTTGCTTCGGTCACTCCTCCTCAAATCCTCGAGCGTGCTcgttcgccgccgccagcgccatctACAC
CCGGCAAATTGCGACAGCTAAGGTCTGCATTTGCTCTGAAAGCAACAGAAGTGCGAGAACAGGAGCCGCTAACAGCTCCGAGCTCACCACCACGAGTTGG
CTCAATCGATGCAAAGCTACCCAAACGTAAGTTCTTTAGTCGAGGTTAGTGGCTTGTTCATGTAGCTGACTCCTCGTGCGTGCGTGTTCCATCAAGCAAA
ACGTATTGGTTGGAAGGAGACGATCgagtactacatgtatcctCTGTTATTGGCGTGCTACACTCGCCaaggaaatgctgctgaGGCCGCCGTAACAGGC
CTCACTCACTGTCTTGACGAAGGTGTATTCGACAGTCCCGGGTCTGATCTATGTCGCCTCGAGGTTGTGATCGATGCAGTCACTTCGGTATGTCAGCAGG
GAATCAAATTTCGCTTTGAGCCCGCGCTTCAGTTCTTTCAAAAGGTACCGAACATGAGCTTGCAACTTTGAATGACCACTCTATCTTGGATTGACCTCTG
TTCAATTGTTTGCTCCTTTTTTGCTAAGGTCATTCGAAAGTGCACGAAAGGGTTTGACCCCTCCGTGCTTCACGCGATCCTGAAGGCGTTAACATTCATT
GGAGACTTTGACGGCTCCCTGGCCAAGTCATTTGAGGACGAGTTGATCTCTAAGATCATGTGCGCTTACGAAGCCACTTTGACCAATACGGAACCCGCGC
CCGTCAAGACACATGCGTCTCAACGCGAACAATCGTCGAATGCCCTTGCTCACGACTTAGTTGTGGACCTCATTGACGACATCAGCACGGGCGCTGAAAT
CGCGACCATAACCGACAATATGCTGGGCGTATTCAAGGTAAATCGTATCATCTACGTGTTGATCCTTGTGTTGACAGTTAAGCTGACGGCGGCTTTGTTG
TGCTATGGGGACGTAGAGTCATTTGTCAATTCAGTCGCTCGCGTTTTGCCACGACATCTCAGCAGCGATGAACAATTTCACCAATTCCGTGGTGCGCTTT
CTCTATTCCTTGTTCTGGTAAACAAATTCAGAGTGCTAACCAACTGCTTTTGGTGCATCCACTAGGTCGAGAAAAATGCTCTTCAGTTGGTGGTGACGTT
TAGCAGAGCTGTTAACCGCAAGTTTGTAGGTCTCAGTGAGACGGCTACTGAAAGCGACCTGTGTTCGAGTGTGGGCTCTCTTCGTGCTCTAAACCAAAca
cttcttgcagctggGACGCGGGCTCGTGAGCGGCGAGTGTTTGGGCAGGTAGTTCGAAGGTTTGTGCTATCGACGCTTAACTCCACGGTGCTCACTTGGG
TGCCGGACGTGTTTCGAGCAAATCTCACGCTGGTGTCAACGTTGTGGAGCCATTACCGACGGTATCtcaaggtggagctggcaTTGATGTTTGAGCACGT
ACTTCTTCGCATCCTACGCGCTAGTGCACCATGCGCGAAGAACCATCAAATGGAGATCATGCACGAGATGACCAATTGGTTGCAGCTCCCACACAATGTC
GTGGAGATCTTCCTCAACTTTGATTTGGATCGAATTCAGCAGTGGAAGATCTTTGAGCACTTGTGCTCGACCCTAGGTTCTATAGGAGAGGGCAGCGTCG
GCCACCTTGCGAATGCTGATGAGGGAGACGATTCCGCCTTGGAATTGCAAAACCAAGCAATCAGTACCATCTTAGCGATGGCTCGCAGCGTGATGGACGC
TAGTGGCCACGCTCACCTTATCAGCCGGGATCAGCGTACGCGTATGCTGTCGATGGACAATGGAGGATGGGAACAAGACGAATCGGGTGAAGAGGCATCA
CCAATGAGGAGCGATTCGTTCATTATGCAAGCAAACGGAGGCTCAAGTGTTGTCCCCTCCGATCGAGCAAGTCAACCGAGTTCGCCAACGGAAGTCAAGA
GCCATTCCGAGCTGACGCGCCAACCGAATCGCAAGTACGGCGGCAACATCTCGGTTCGGATGCGAAACGAACTCCAGAAAcacaaccagcagctgctgaa
gcgtgCGATGGAGTTATCCTCATCAAAgagcttgaa