Description :
From Genome Similarity Track
Location :
Scaffold_87:3381- 5551
Transcript NameFunction/comments
Aphas_H257_16778Golgi membrane sorting nexin

Sequence
2170 bases(100 bases per row)
GACGGTGTGTGTGCACCTCGTACGTAGACCCCACAAGTCGTCGGTAGCGATTCCCCTCCTTTCGTTGTGGTGCTGCACATGGGGTGCCTGTTTTTGTGCC
AGTCGGTACTGGCGTCAGCAGGGATATGGCCAACGCGGCAACTCACGTCGTCGTCGCCTGAAGTTCTCGCCTTGGCTCGAGCTCACATCATATCGTTCAG
TGGCAAGTCACTTGTCCACCGCTCAACTGCCCTCCATTCAGGTTTTAGTTTACACCAGCAGCAACATCCCACCCCCACAAGTTATGGTTCGATTGGCCAA
GCCAAAACCTTGAGCTGTGCTACTACCCCCCAGCACGATGTCACGTTGCCCTGCCACCCAACGTTGAAGATTTGCATTCCAAGCTGGACAGTGTCACGGA
GGTCCGAGTCTTCGTATGTGTCGTACAAGGTATACACACGTTTCGTTGATTGTTCACGTCATAAACAAGCACTAGATTCTCATCATGTCGGGGCACGACG
AGACTTGGAGTGTGCGCCGTCGGTACAGCGACTTTGCCCATTTGCGCCGTGGGGTACTGTATTTTGTTGCACCGACTTTCATATCCGAGTATTACATTCA
TGTACAACAACTCGTGCGATTGCGTAGCTCCCGTCATGGATGACAGACCATGTGCCCTTTCCAGACAAATCGCACTTGCAGCGCTTTGCACCTCAGGTCA
TTGACACCCGCCGCGCGCTGTTGGAATCGTTTTTGAACGTACTTTAAACTGGATGGTGGCCATACATTATTGACGGCAACCGTGTAGTCGGTCGTGGCGC
ACCCTGATTTCGACGCCCGGGCGTCGCTCGCGTTGTGTGATTTCCTCGATTTGGTACGCCTTGTCATGACAAGGACAGCACTGTCGCCTTACCACGACTG
AATGCTTTAGGAATACATTGCCAACCCCAACGACTATCTCGTGTAATCCAAACCCGAAATGTCAACCTTGAGACAGATTTATCAAAGTTAGTATTATCCA
CAAACATAAGGATGCTTTTACTGTATAAAGTAAATAGAATGAAAAGAATACCAGTAGCGTTACACTGAAATTCTTGCATAAATCCAAGAGTAACGTTAGG
TAAAATAATAAAACAAAATAATAAGGCTGGCTTTCTACTACGCGCTCTTTCTTGTGGGTGGGTGAGAGTCGCGGACCTGATCGGCGCTTGATGTACTTGG
CGAATTTCGACATTTTAAGCACATTAAGAACTGTTGTTTGTGTTACTTTACCACTGAGTACTGCAGCTATTTGCCTTGACGACATGCCCTTCAGTGTAGC
GAGACGCAAAACTCGTCGAATCTCTCGATTGGTCAGTGTGGTGCGTCTTCCTGGGCGTTTGGGTGCAGCAGGTCGCTTCAAACTTGCAACGTACGTCCGC
ACGAGTTTGTCACTGCGTCCAATGGCCCTTGCAATCCAACGCAACCATTTATTGACATCCAAATAGGCTTTAACTTGGCCTTTCTCGACATCGGTGATGT
TTTCGCGGCATGGTGAAATGGTTTTACTGTTGCTGATGATATGGGTGTGTATCTGCACCGGTGCCAGCAGGCGCTGGAGCCGGGGACGGTCGTGAGGTCA
GCGTTAAGGACGCGAGGCAGCGACGTGATGGGGCACCTAGGCCAATGCTAATCAACGGAAAAGATGAAGGACCGGGACATGGACTTGTAGGCCGCTGGGG
TCTCCTTGGCCACATCTTATGGGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGACACCGGAGGATGTGGCCAAGGAAGCCCCAGCGGGAGCGGAGCAGGCGGAAGCACCTTGGCGACCGCATCGG
CGCAGTCGCGAAGGAGCTTGGAATGACGGGGGAAGCCCTAGCGGGAGCGGAGCAGGCGGAAGCTCCCTGGCGACCGCATCGGCGCAGTGGCGAAGGAACT
TGGAATGGGGAACAAAGCCACGCAATCGATCGAGTCACAGATGATTATGATTGGTCAGTTGACTTACTGGAGTCCAGTACTCCAACAAAAATTCCAACAA
ATTTACTGGAATATTTGTTGGAGTAGTGGAGTCCAGTAACTTTTTTACTGGCTATTGGTACCGGTGCGAA