Description :
From Genome Similarity Track
Location :
Scaffold_1070:3381- 5130
Sequence
1749 bases(100 bases per row)
AGTACCAACGAAGTCGAGTCACCACTCTCCTTCGCCTCTTCATCAGGAACCTGAGCCTCGGCAGCTGGAGCTGCAGCCTGACCCTGCGAATCCTCGTCAC
CAGCTTCAACAGGAGCGGCAGCCAGAGCGGGACGTGGGGTACCCGGTGGCGAGTCAAACAACGAACGCCAGGTCGGGATAAACTCATTTGCATCCAGGGA
CGGATCAACAAGCACGCTTCGGTACACATCCGCGAAACGCGTACCACGAGGATTGAAAAGCTCCGAACCACACTGGCACGGGACGTACGTGGTGTTGTAC
GGGTGCTGATGTGGCGCGTTCATCCATCCAGTACGCCAGGGCTGACGAGCATCGAGAGTCGGAACTTCGGAAAGCCGGTCGGAAGCCCGAGGTGCGAACG
GCAAGTTCTCGATCGGCTTCCATGGTTTAGACGGCACCAAAAGCAACTCAGGACGTATGAACGGCGTGTCGGAAGTACCAGAAGAAACCGAGTCACGACT
CCACGCCATGTACTGTTTTCGGTACTTGTTACGGAGACGACCGGCACGACGGTCCCGCTCACTGAAGAGCTTCTTCAACAGAGGTCTCAGTTCCTTCAAG
AGCTCCTTGTCGGGGCCGCCCTTCTTGGCTTCTTCAACAAGGCCTCGCTCAATGCCTGCCGGCGGAAGCCAGTGGAGACGCTCTTACAACGCGAACCCGA
GGTCACCCTGCTTGCCGCCGTCACCCCGAAGGCTCGCCCAGATCATCTTGAGACGAGCTCCAATCGGAGCACACTTGGCGATGGGGACGCTTGGATCGGA
GTCGACGGCGTCGAAGAGACACGCCTGAAGAGGATAGAGCTGCCGAAGTTGCTGGTACGGGTGATCAGGATTCGAGTAGTCGAAGTACGCTTGGAGACCC
TCCAACGTCGTATGGACTGTTACCTCATCAGCTGGTCGGGAAGGGTCATACTCAAGAGTCACTCGAAACACTTCTTAGCACCTGCGTCGGCAAACTCCAT
GTCCAAGTACGGAAGAACCCACGGTGGCAATGTGGACAAGGCCGGTATCGTAGGGCGAGCACCAGGCAACACGCGGTGAGGCAACGACTCAACCGACGGT
GCACCACCACGACGCGGCACCGAAGTGTAAGTGGCCGTGATCTGGCGCCCAGGTCCAGCATCGAGAGTCCGAGAGAACGGACGAGGAGACACCGGAACAG
GAGGTGAAGATGGTGGTGCTTCGTGGCTTGCCAATGACGGAGGAGGCGGACCACCGACTATGATCGGAGAAGTGACCATCGGCGAAGGATTATGGCCGCG
AAGGTGTCGGAGGCCGAGCAGGGCCAAGACCGCTCCAGTTGCCGTCGGAATCTTCGACATCTTCGTCATCGACTGTGCTTGAAAACTCGGTAGGTGGCGG
AACATCACCGTCACCACTTGGACCATCAGGAGAATCATCCTCCGAAAGTTCATCGTCATCCACGTTATCTCCACGATCGTCATCAACATTTCCAGCGTCA
TCAATCTCCATTGAAAGGACGGGCGAAGAAACGCTTGGCACGGCAGCTGTCGGAACAGTCGGAGCCGGCTTTGAAGATACGGAGGCTTGTGGAGCAGCTT
CAACAGGGGCAGGCCCTGCTGTAGAAACCACTCCCGAGACTTCAACTGTCTTGGACGCCGCAGCAGACGACGAAGTAGCCTTGCCTTGTGGGACAGTGTT
GTCCGATTCTTCACCTTTATAACTTGAGCCAAACATGAGTCTAAATTGC