Description :
From Genome Similarity Track
Location :
Scaffold_25:338025- 339386
Transcript NameFunction/comments
g13381.t1hypothetical protein

Sequence
1361 bases(100 bases per row)
CTGGCGGACGTGGAGAACCTGGACGCTCTCACGCACCTGCACGAACCCGCTTTCGTGGACTATTTGGCGCAGCGCTACGGCGTGGACCAAGTGTACTGCC
GATCAGGCGCGGTGCTCATCGCCGTGAACCCGTTCAAAGAGATCGAGGGTCTCTACAACCTGCAGAAATACCACGATGAGATGCCCGGCTGGACGGCGCT
ACCCCCACACGTTTTTTCTATTGCAGAAGGAGCTTATCGGTCGCTGAGGCGACGACTGCACGAGCCTGGAGAGAGCAAGAAGAACCAGACGATCCTCGTG
AGCGGCGAGAGCGGCGCCGGCAAGACAGAGACCACCAAGTTTATCATGAATTATTTAGCAGAGAGCAGTCGGGACTCAGCAGCGACCAGCAGTAATAAGA
GGAAGCGGGCGATCAGTGGCAGTGAGTTGATGAGCGCGAACCCGATTCTAGAATGTTTCGGCAATGCACGGACGCTGAGGAACGACAACAGTAGTCGATT
TGGAAAGTTTGTACGCATGTTCTTTGATGGACACGAGTTGGATGCGTCCCTGAGGATGGTGGGCACGTCCGTGGAGACGTACCTTTTGGAAAAGGTGCGC
GTGGTGCATCAGAATGACGGCGAGCGGAATTTCCACGTGTTTTATGAACTGCTGGCTGGGGCGGATGATGCTATGAAGAGCGAGCTGCATCTCGTAAACC
TCTCAGCGCAGGAGTTCCAGTACATCAATGGTGGACAATGCTTCCAGCGCAACGACGGCGTGCGTGATGATAAACAGTTCCAGTTGGTGCTCCAGTCGAT
GAAAGTGCTGGGGTTCACGGACGTTGAGCGAGGAGCAATCTGGAAAATCTTGAGTGCGCTGCTACATCTTGGAAATGTATTGTTTGTTTCCTCGAGCGAG
GATGAGGGAGAGGACGATAATGGAACGGCGTCAGCACCGTGTCGACTCGCCTCTTCATCACCTTCGTCGCTTACTGTTCAGGAGCATCTTGATATCGTAG
CAAGGCTTTTTGCTGTGGATCAGGAAGAGCTGGTGTCGGCGCTCACGACCCGAAAAATCAGTGTTGGTGGCGAAACTTTCCATTCAAATCTGAGCCTCGC
GCAGTGTGGAGATGCTCGAGATGCAATGGCTCGCTCATTGTACTCGTTCCTTTTCCAGTTCTTGGTCTCAAAAGTAAATTCAGCCTCGCCACAAGTCGCA
CCACCTTCAAATCCTGCCAATAAAACAACGAACAGGGATGCAGCACCATGTATTGCAGTTCTGGACATCTTCGGCTTCGAAGAATTTGTGATCAATCAGT
TCGAACAGTTTTGCATTAATTACGCGAACGAAAAGCTGCAGTATCAGTTTATCCAGGATAT