Description :
From Genome Similarity Track
Location :
Scaffold_990:338- 2553
Sequence
2215 bases(100 bases per row)
GTCAAGGCAGCTGTGGATGCGTTTTGTGGCAGCTGCCCGGCTGGGAAGTAGTGGATGCGCAAGGATTTATCTTGGAGGATGTCACTGTGAATGATGCTGA
GTATCATGGGCTAATAAATGGCCTGAAACTGGCATTGTCTCGCAACGTTGAGAACCTGGTTGCAGTTGGTGATTCAAGAATTGTGATTCAGCAAGCTCAG
GGCCTGATAAATTGTAATACTCCGAACCTTCAGCGCCGACTTGCCGAATATGAAGCTCTCAAAGCCAAGTTCAAGTCAGTTCAACTGGTACACGTCAAGC
GCTTCTACAATCAAGCAGCAGATTATCTGACGTCTAAAACATTGATGTTGGGTGAGTCTTGGCGAGTTGAGGACGAAGATGAACGACTCCATCTGCAATT
GGTATCAAAGATCCCTGAGCAAGTCATGAAACCGACTGAGACTCTGACTGGAGATAAAGATTCGAAGTTTGAATCTGAATCAAGTCCTCTTCCTCCTGCG
GCCAAGGTTCTAGCAGCGTTTACACGATCTCAGGTCGAGCGATCAGGATCAGCTGAACCTTTGGAACCGCTGCAGTATCAGGCAGAACGTTGGCGCCGAA
TCAAGGCTCATCAAGATGGTGACGCTTTCTTCAAGCGGATAAAAAGCTATCTGAAAGGCGAGTTGGATGAATTTTCCCGATCTGAGGTCAAGAAACTTGC
CAAGTATGCGGATTGCTACGTTCTGGACTCACGAGAAGTGCTGTACCGCTTGGCTGCAGAAACTAAGGGACGCCCTCGTAACAGAGAGTCTGAGCTGAGA
TTAGTTGTTCCTGAAAGCTTGCGTCCAGACATGTTGCACTATGTGCACGAGGATTTTCAAGGTGGGCATCAAGGCATAACTCGCACGTATCAACGATTGT
GTGCAGAGTTTTATTGGCCAGGTATGTTCGCTGATGTGGAGATTTTTGTCAAAGAGTGCACTGATTGTGCGTCGGCCAAGGGACGACCTCCTAATTCTGG
ACCTTCACCTGGAAATATCGAACCTCAGCGCCCGTTTGAGCTAGTGTCAATGGACTTTGTCACCCATATGCCCAAATCTGAACGCGGAAATACTTTTCTG
CTCCTGTTTCAGGATTCATTTTCAGGCTACGTGATGTGCAAGCCCATGAGTTCGACCACTGCCCAAGAAGTTGCAGAGGCTTACGAGGAATGTGTGTTCA
GGCGTTTCGGAGCAAGTTCAATGCTGAGGCATGACCAGGATCCAAGGTTCATGAGTGAAGTTTTTACCCGATTCCGGGAAATGCTGGGTAGCAGGCAACG
AGCAACCCTAGCATATCGACCTCAAGCTAACGGCCAGCAAGAGCGGTCGGTCCAAACGGTAATGCGAAGTGTCCGTGCTTACGTGGCTGAATCAGATCAA
AGCGACTGGGACGATCACGCTGAACGTTTGATGTTTGCCCTGAACACGTCTTTTGACGCCACCCGGTTAGATACACCATTTTACTTGGTGCATGGTTGGG
ATGCTCAAGGGACGGTGTCAGCAATGCTTGGACCCAAACCTTCAGGCGTTGTTGAACGTACCGCTTACGAATGGCGTCGGAAGTTACAACGTGACTATAG
CTACGCCCAGGCCTGTGCCAAAGACCTTCAGATAAAGGCGAAACGACAGCGCTCAGAAGCTCAGACAGAGAAATGGAAGGAGTTGTCAGAGCGTCTCAAA
GCCGGTTTCAAGGTTGGCGATGCTGTATGGCTATACATCCCCAAGGTGCAGACTGGTTTGAGCAGGAAGTTGGCTCATATGTGGCATGGTCCGTTCAGGA
TAGATGAGATGCATGATGATTTCAGAGTCAAGCTGAGAGTCACCAACACTGGATATCGGGTCAACCCTTGGGTGCATGTGAGTCGCCTGAAACCGAGAGC
TTGGTTCCCGAAACGTCCAGTTGAAGCAATCGAGTTGGACGAGGATGATGATTTTGACACCGCTTTGTTACCCGAGGACAGCTGGGAGGCAGACAATCTG
AACGACGAGTTTGAAGTTGAGAAAATTCTGGATCTGCGTTGGAATAAACGCACTCGAACTGCACGACCCACACGAGAGTATCTCGTGAAATGGAAGGGCT
ATGAGGAACCAGAATGGTTACCAGTTTCGCAACTGAGTTGTGGTGCCCTCCTGTATGAATTCAATCAAGGCGCTAGAGCGAGAGCTCGCTTCAGGACCAT
GCAGGCAGGAGATGA