Description :
From Genome Similarity Track
Location :
Scaffold_1820:338- 1945
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_1820-abinit-gene-0.17G10
Pytar_ATCC12531maker-par_contig_1820-fgenesh-gene-0.2MMP37

Sequence
1607 bases(100 bases per row)
GCGATGTCCAAGTGGACCAAGAAGGGCCGCGCGCCGGCGGGCTACGAGTACATCCAGCCCGTCATGGACGCGCTGGAGCGTGAGCTGCGCGAGAAGATGA
ACGAGCCCCACGAGGGCAAGCGCAAGTGCGAGGCGCTGTGGCCCGTCCACCAGATCAACTGGCAGCGCAGCCGCTACGTGTACGACATGTTCTACAAGTA
CCAGCGCATCTCCAAGGAGGTCTACGAGTACTGCATCCGCATGAAGCTCGTGGACGCCAACCTCATCGCCAAGTGGAAAAAGCCCGGGTACGAGCGGCTC
TGCAGTACCTATGCGATCAACACCAAGAACTACAACTACGGCACGGTCAGTATCTGCCGCGTGCCGCGCCACCAGCTCTCGGACGACCAGGTGATCCAGG
AAAAGCACAGCGGCTGCAGAGGGTGCGCATCCGGACCCGGCGGGTACCACAACATATTCGGTACCAAGTACGGGCAGTACCTCGCGCGCATCCAGATCGC
ACGGGAGAAGGCTGGCCAGAGTGCCCCAGGCGCCGGTCCGGTCTGGGCCGAAGAAACCGAAGAAGCCAAGTACAACAGCGATGCGGAAGACGATGACGAC
GAAGAGGATGCGCCTGGTCCCAAGCCACCGACGGCTGCGCAGCGCAAGCGCCAACACTCGGAGAGCGACGGGGAGCCAGCAGCAAAGGAGACTGCGTCCA
CTGACGAAAGCAGCGACGAGGACGAGGCGTCTGGCGAAGAGGAAGAAAAGCATTCGGAAAAGACCAAGAAGCAGAAGCGATCGTAGAGATAGTATCTCTC
TAGGCGTTGAATTCTAACTCACCACACACCAGGCACGAGAACCCATTTCGGGAGCTTTCCATCGGAGCGGAACTTGTCGAGGTACCACTGCTTCCCGTAG
AAGGCGCAGATGGATTGGTTGAGCACCACCCACGCGAGCACGAGATTGACCATGGGGTTGAGTAGCCCACACACGAGCGCCAGCCCCACGTAGATAAGCA
GCTCGGTCGAGTACAGTGGACACAGCACGTGGTCGAACCACCGCCCGCGCGGCAGAACGTGCTTGCCGCCGCTTGCGCGCTTCTGCTGGGCGAGCATTTT
GTTGTGGCCGTACTGCTCGAAGCTTCCATAGAGAAACAACACCAAGCCAGCGACTTGGAGTAGACTGGTCGAGTGGTCGTTCGCGTCATCGGCACGCGAC
TGCGGAGTGGACAGCACGGACGGCGCGATACCCAGATAGTGGATGAGTCCTGCCACGAGCACTGTGCATACAGAGACGTCATGTGAGTTTTAAAACAATA
GTGATCATGAACTGCCATGCCGTACATGCGACGTGCATCTTGGCATCCCCAAACTCCGTGATGAACACCGACTCGAGGAAACGGCGCGTGTCCTGCAGGC
CAAGCAGCGCGATCACGGCGATCGCGTCCGAGCGGATCTCCACAAACGCTGGTGCGTGTGTTTGATCAGCAGGAGTCCACGACTGAAGGACTCTGAGGAG
CTGCTGCGTGAGCGCATGGTGTGGCGCAGCGATCAGCGCGATGGCGATGCCCAGATTATAGACGGCGCCGGCGAAGTAGAAGTAGATCCAGCCGCTCTTG
CGCATCT