Description :
From Genome Similarity Track
Location :
Scaffold_2939:338- 1816
Transcript NameFunction/comments
Phypl_g15505reverse transcriptase

Sequence
1478 bases(100 bases per row)
ACACTTGACCACACTGACCGAGAGGTTCCACTGCTCGCAAGCGTCCAGCAGGCGATCTACCTTTGCGCAAAGGATGTCCCAAGATTCGGCCGTCACCaag
atgtcgtcgatgtacGATCGTCGTCCCAGGATGGACGGCTTCAGATCGGTGTCAGGTTCGCCACTCTCGAAGACGTCACTCGTCTCTGTCAAGTCTGGAT
CCGCGCTAATCTTCAGGTGTCCGTACAGCGCATGTCGATGAGCCACTGATAGATCTGAGGTGCGTTCTTCAATCCGAATGGCATACACAGCCACTCGAAA
AGCCCGAATGGGGTGATGAACGCTGAGATCAGCCGCGCTCGCTCGGTCATGGTGACCACCCAGAATCCACTCGCCATGTCAAGAGAGCAGTACCAAAGCA
TcttgtccgagtcgtccagAAGATTGTTGATCAGCGGCATCGGATACGCCATCAAGCGCGTCAGGCCGTTGACGACTCTGTAATCAATGCAGAGTCGAAT
ATCAacgccgttcttcttgacgatgaTCACGATCGGGGATGCCCACGGTGAGGTCGAGTGCTTGATGATCATAGCCGACAGCAGACCCTTGATGAGCGCA
GCCAACTTCTCTCGAAATTGTGGAGCAACCGGTCGCACGCACTGGGCTACTGGAGTGGCACCAccgacgtcgatgtcgcacagtgcaccgcgtgctgcag
gtggcagGGCGTTCCCTTTTCCGATCAGCAAgtgccgccttcgccagATGATCCGTCGCAGCCGATCGATCTCTTCCGAGGTATTCAGATCGGGATCGCC
AACCTGAATGTCTTCGATCATTACCCCTTCAGTCGAAGATGCTACCTCGGGCAAGATGACCAAGTTCCGTTCGAGATCTTCTGCGAACAAGCCGCCGCCC
TCATGGTAGCAGACCTGTTCTGCCTTAGCTTCAGCCGAGCTCGATTCCAGTGAAGTATCGACTTCGGTCTTCGGCAGATCTTGTCTTGACTTGGCGGACC
CCTCTTTCTGGATCGGTGCAGGCTCCTGGGCGACTCGCTCTTCGTCCACCTCTTCACGCTTCACCTCGGCTTTCGGCAGACCTTCCCGTGTTCCTTCGCA
GGGCGATGGTAAGACTGTTGCTACGGCCACCACTGGTTTAGGAAGCCCATCCGACCGACTCAGAAttcgcgtcggcgtcggatATTGAGGCCGATCCACC
AGCGGTTCCACTGACTCTTCTTCGGGTCCGGGTTCCTCCTGTCGCTCGGTGGTAGCCTCGAACGCGAGGTTCTGTCACTCAGCGTATCTGGGCGATCCGA
CTGAAACAAAACCTGGCATACGAGGTACGGCGTCTGGGGCTAACCGAGTTCCTAGCCGTGCGTGCCGATCGAGCACTAACTTCTCTTCGCTCACGTTTGT
GATCCGCAGATACCTCGTTCTACCCAGACCCCTGATAGCGGTCGGCACCCATCTTGATCCCCGTGTGATCCAGAGCTT