Description :
From Genome Similarity Track
Location :
Scaffold_1867:338- 1417
Transcript NameFunction/comments
Phyag_g11641conserved hypothetical protein

Sequence
1079 bases(100 bases per row)
AGAATCGTCTCAACGTCTTCTGGTTTCGTCGGCCGAAGTCCGAGTCGAAGTGAGTAGCAGCCATCTTGACGGGATTGAATGCACTTATTTCTCTCTTTAC
TTGCAAAAATTGAGATGGAAATGGGGTACATACATATATCGGCTTGATGTTCCATGAGCAATGGGtagtgctgcatctgcaaccAGCAAGGGTGAAGGTG
GTAAAACTTGAGTCGTAATGGTGTGCCATGCTTCTCAGGAACATCCACTACGAGTCGTTGCTTCGCATAGCAAGAGGTGACGACGAACCGAGCAGTACCG
AAGACGTCGTAGTCGTTATCGATTCATACCCGCGAGATCAACATAGAACAGAGTTGCTGCCTCAAGCCGAAGCAGCTTCGTTATAATTGATCCGATGCTT
CATCGCAGCTCCGAATTGATCGACACGCTGTCATACCTCAAAGACCAGCGAAAGACTGTCATCTCTGGACCGCTGACTTTCTTTTCATGACCATCAGAAG
TCAATAGCCAAgccagtgagtagcaactaggaataaccagttaatcaactcaatttcctttCCTTTTCATGACCATCAGGGGCTGTCGGGGTGTGTATTT
CGCAATCAGTGGGCCCCACTGTTGTTTGCTGAACCGGAGAGAATCGCGTATTAGACGGAGAAGTACGAACTCTTGACTTGCTCGGGGATGAAAATGAAGG
TCAGCAATAGCATTGAGGACGTCAATATTGAAGCAAGCTGTGGATTCGAACTGCCATCGTCTCCACAAATTAATTGCTTTTGGCGAACCTCAAATTGACC
CCCACGCCTCCGATGACCACTTCGCGTCATTACATGCCTCTACAAAGCGATATGGCACCAATAAGTCACCATTCTTACAAGTACTTCTACAAGTTCATTT
CAACACGACGTTTGTGGTGAACAaagtacttcgaagtagtaGCCAACACGCTTGAATCAGACTACGATCTTCATTTCTCTTACATGTATCAACGCGACGC
ATACTGCAGGGCACATTGTTCAGCTATTCTATCCTGATCTATGCTTTGCTAGGCGTGTACGGCTTAAAGAAGCTCTCAC