Description :
From Genome Similarity Track
Location :
Scaffold_4:337889- 342047
Transcript NameFunction/comments
Physo_128220putative protein serine/threonine kinase
Physo_128221hypothetical protein

Sequence
4158 bases(100 bases per row)
GGGTTGGCACCGGATCCTTGATCCTCATTCATCTCCTCCATAAGACGACGGAGCTCGACAGCATCTTCGCGCTCAGCAAGGACTTCCTTCGAGCGGTTAA
GACCTCCACCGCCACTACGGAACAGATTCTTCGGACCGCGTTTAGTATCTGTGCCTCCCAGGATATCGGCTTCGACATCGGCACCCAGCTCATCGAGTTC
ATCGTCACCATCCGACTCCTCATCCGACGAAAACGTAGTTTTGGTCGAGCTCAGAACGTCCATTTGGCGCTCATAGATCACATCACACTTCTTGCGATAC
TCTTGTTGCTGTGCTGAAAGCGACTTGCGCGCGCCACGGGCGAACTTGCTCAAACTACCGGCCACACCGTGGGCTGTTGCACGACTACTGAGCTCACGCA
CCATGTGAATTCGATCCCAACGGCGCAGTTTCTTGATATCTGCGTCGGCCAAACCCAGGTTTCGCAGCACATCACCAGCTTCCTTCATTTTCAGCTTACG
CAAATCGGCAGTCGTACCAGTGACCGCTGCCACTGCCTTCTGCACAGCTGCAGTTTCAGCGCTTATCTTGCTCTCAGCAGTCGGCGCCACGTCATCCTCT
CCGTCTTTCTTCTTGGCACGGGACTGCGGTACGCGCACGAAGCTGAAACCTTCACCACGACCAGTTGGGTCACCAATACCACCGAGCTGCAACATACCAG
ATCCTTTGCCCTGAAGGTGGCATTCGACGTAGTTGTTTGTCAAATTCCAAGGCGTGAGCTGCAGCTGCTCATTGATGTAACGAGCAACTTGAATATCAGT
CTCGAGCTTGCGCACCACAGGGTCCTTCTTCCAAAGATCAGCCTGGGCCCTCTCTCGGGCACGTCGCTCAAGGTTGGCTGGCACAAGACGCGTGGACAAC
GTATTTTTGCGCAGCTCAAGGCGTCGAATCAAGTGATTGATGGCCCCATTCACACCAGAAGGTGTAAACAACTTGGTCAGTCCAATATCCAGTAGTCGTC
TGTGGCCAGACATCATACTTTCGTAGAGGCACACACTCTCAGGAGGAATACTGGCCCTGATTTCTTCCTCGCTCTGCAATTGCGATGCAGGTTTCTTTTT
CCACCAGCCCGAGTCATTACCACCGCGCTCAAAAGTAGCCACCTCCTTCATGCGTTTTCGGATAGCAGTGCCTGACTGATTCGGGAATGCACGCGCAATA
TCCTCAATCTTCAATCGCTCGCCATCGCTAGCTTTCTTGAATAGCCGTAGGATGTGGAACGACATGTATGGGCGAATAAACTCGTTGGCACTGCGAGAAT
TCGGTGCTGGCACCTCGATTTGAGGTTCGATTTGCCCTGCCACGAAAACTTCAGGCAGCTCCATGATGAACACCGTTGTCTTTGGGGTTCCAAGCCCGCC
CGACTTATCACCAGCTGCGCCCTTCTTCCCCTTCGTCACAGACCGACACAAAAGGAAAATATCCGAGTTGTTGCGTTCACGTGAATCTGGACTTGCAGCA
AACGGAACCGTTGGCTTGTGAGGGAAAATCGGCACCTTGTACAGCTTCGAGTTGAGTGATGTTACCACTCGCCCCGGAGGAATATCACCGACAAACGGAG
ACTCATCGTGGTCACCGAGCGTAATGACCTGCCCCATTTTCATGTCAGGTGGCTTTGGGCGCGTCTTGCGAGCTTTCTTCTTACCCAGTATGCCCAATCC
TGCAGATGTATCCTCCGGTGGCCGCCAGTAGTGAAGGATACGGGCCGCCATACCAGGGTTTGACAGCATGGGCGGGTGCTGCTCTGTGTACTCGATGAGA
ATCAGCTTACCACCAGCGGTGGGATTCAAGTCGGAACTCTTCTTGATCTGAGTAACCATGGCGCTTTCCTCCTGCGGTGCCAACTTGGCGGCACCTGGGG
GCGGCGGCAAGAATTGCAGCCGCTCATTGATTTTGAACTTGCCGCGTGGTCGGTGAAAGTCTCGGAGTTTTGCCTTAGGAAGTTCAGGCTTTGTGAGCGA
GAGCTTCATGGCGGGCAGAGAGTGGTGTACGTAGCCAATGTTCTTCACCACACGCGTGTCCTTCGACTTCTTACCGCTGCCTTCCGTGCCCAATCGACCT
TCAGCCGTCTCCTCACCAAACTCAAGGTTACCCATGACCTCATCAATACGCTGTTTCTTCTCGATACGCTGTTTGTCAAGCTGCGCCAGGCGCTGCTCAG
CCGCTCCCAACTTGCGTTCCGGAATGCGAAGCGTAGGACGTACGTCCTCCATCTCAGGAACCGAGTAAATGAGCGACGCATCGTTGTCATCCAGCACCAG
TTTGCTCTCCGCCATATCCTGTGTAGACTTCCAGCCAATCGCCGCCACCCACGAGTCATCCTGCAACTCCTTGTTCAGTGGACACGGCAGCGTCTCCTTC
TCTCCCTTCTCCGCATTCCCCGATCCATTGGCAGTCTCCTCTCCACGTTTCTTCTCCTTCGCGTTATCCTCCAGCTCCCAGCGGTAATTCCGTGGCTTGG
TCATATCAAAGCCACCACTAAAACCCGCCGTCGCCAACGACGAATTCTCAGTCTCCTGACCCGCTCTAGCAGCACGCAGCTCCTTGTACGACTGAACACT
CGTCCCCGAACTCTCCTCACTCTTCTTTTCAGCAGGCTTCGCCCAACCACCAGCCTTACTCGCCGCCTTGCTCTTGGTCTCCTTCACCACAGTCACTGCA
CCCACCGAGTCCTCGACTTCCACTCCCTCGTCCTCCTCCTCCGTCTTCCCACCCTTGGCCGCAGCCGCAAAGTCGATGCCCCAAATGATGTTCTCCTCCC
AGGGTAGCTGCTGCACCTTGTGGTACTGCGCGTCGCCCTCCTCCTCCGAGTCCGTGAGTGCGCTGGGCCTGCCACCCGTGGCCGCCATTGTGACGAACGG
CGTGGCGGACCACGCCACGAAGCGTCTCATGGGCTTCCCCTTGGCCTCCGCAGCCCGGGGAGGGTGCGACTGCATCGTCTGCTCCTTGCCCGCCGCGTTC
TCGGCGCCGACGGCCTCCTGCGTCGTCAGCAGCTGCTGCAGTTGGTCCGGCGCGAACCGCGCCGCTGCGTCCGCCTGCGTCTGCTGCTGCGCCTTGTGCT
CGATCGTGACGTCCTCCAGCTCCTTCTCCAGCGCGCGCAGCGTCGCCACGAGCTCCGAGTCGCGCGAGGAGCGCTGGTACAGCGCGGCGAAGTTGACGGG
CTCGGAGCGAGGACTCGTCGGCTTCTTTCCGGGCGAAGACGCGTCCGTCGGCGACGCGGCGGGCGTCAGCGGCTTCGCCGGGAAGGAAGCTTCCCTCCCG
GCCGGGGCGGAGGGGGCGGCGGCGCCCGTGGGGCTGCACAGCGCCGTCTCCATGGGACTGGAGGCGACCATCACTCCGTCCACTTGCTGTGTGGGCGCCA
TAATGCGGACTGACCCAAAGAGACGTCAGAGAAAGGGGCGGGCTCCAGGTTCCAGGTTGATGTTCCAGTTAGTAGGAGCAGGCAGGTCCCATCAATTCTG
GAACCTGGAATTGGAGATAGCTACATCTGCACATGAATCGGCTCAAGCTGGATGAGACGGCGCTGGACCTGTTCGCTCGGCGGCCGACGCGCAGCTTCTC
GACGAGGCTGAGCTTCCTGGACGCGGCGACTGCTAACCGAGACGGAGTAGAAGCTGGCTACCGGCCGCGACAGGTTGTAGAGCTGTGTGGAGCGAGCGAC
ACGCCCAAGACTCGAGTGCTGGAGCACGTCGTGTCCTCCTTCCTCACCAAAAGCTGCGGGGCGAGCGCCCAGCCGCCCAAAGAGCGCGTCTTCATCTTCG
ACCACGAGTGCGAGGTGTCGGCAGAGCGGTTGAAGGATCTGGTGGCCGACAGACTGGCGGGGAGCAAGAGGGAAGACGCTCTGGAGGAGGCGCTGGGACG
CGTGCAGACGTACCACTGCCGAGACTCGTTCCAGTGGCTCGCGACGCTCAATGATATCCACTTCCAGTTGTTAGAGGCCCCTCCGGCGCGTGAGTATTGA
GGTTGCAAGGGTGTTTTTCAGTGGTTGGGAGGTTGATGGTGTGGGTGCGTTTGATGTTGTCCAGCGTTGATGCTGGTGTTCAACTGTGTGGGGTCCTTCC
ACGTTATTGACAAGGTGAGGAGATGCGGTGGTGGGAAATCGAGCGGCGAAGCTAACGG