Description :
From Genome Similarity Track
Location :
scaffold_37:337844- 340036
Transcript NameFunction/comments
Plaha_PHALS_09289low quality protein: nitrogen permease regulator 3-like protein

Sequence
2192 bases(100 bases per row)
GCGAGTACACTCTTTCCTAACGACACGTCAATTAATGTTTGTGGATCCACTTCAACTGTTGATGTTCCATTTTCTCCATCTTTTCTGTGGTGATGATGAT
GTGATCCACTTGTCGTAGTGTTATTGTTTGAAATATTACTTCCATTCGTCGTATTTGCTGCAGCTACACAAGAAGTATTCCCATTACTCGTTCCTGGAAT
ACCATTGTTAGTACTGCCTGTATTACGTTCACTTTGTGCCAATTCATCTCGTAATTGCAGCAACTCACGCACTTCTTTTGACACATAACCTACTCGAATT
TCTTCGTGCAAAAGTCCATTAGCCAGCTGAGCTGCTACTGTTTGAAATGCTTGAGCGCTGCTTTGTCTTCTGGCCTGAAATTCCTCTTCATCAGTCTGTT
GCAAAGGAAGCAGCTGCGTATTCATAAATCCATTTGAAACTTTGACTTTTGACATTTGTGGTGGAGGATCTTCGAGTGCAAAGATAATATTAAACATTGT
CGTCTCGTTTCCTGTTGTACCATCATCGCTATTGGATGACTGCTCTAAACCTGTAGAAGGTGCTAATGCTGACGATGCAGAGCTATTTATCTGTGTGATA
CCAATTCCCGAACTATCCACAGACGTTGCAGCTAAAATTCGCCGCGAAACAAGCACTGGATGACTTACAAAACGTAGATCGTCGACCACGAGCTCGAAAC
TGGCGTTGCAAAGTGCATTCTTTGGACGAAACAATTTGGCTAATAATGGCGCAGGAAGCGTTTGAAAACTTGATGTATTGTCACTTGATGATGAAGGATA
TCGAAAGGCTAGATTACAACCTTTGCTGATGTCGTCGACTACAAGAGCGATGCCTAAGAGTCGGTAGCCGTCCCTGGCGTTCATCTTAAACTATTATGAA
GTTTTATTATATTAACAAGTCACTTGATTAGTCCATTCCGAAAAGAGTACAAAATACAATATCCGTGACAGTATGACCTAGTAGAGCCGTTGTCCATCCA
GTCGTAATTGTGGACGGCGCTGTGGTCATAACGTAGTGGCGAATGAGTGAACATTACGGCAGCCATACTACATTAGCTGTGGTGGTCGCAAGCTCTTATC
CAACACCATGAAAGATCTACTTTACGATGACAAGAAAAAGTGATTAAGACGTGGATCGCTGTCATTTGTGCATATCTCCACAAGACAACGTCCTGCCTAA
GAAATTGCCTTCGTCACAGCATTGAGTTTAAAATTGCATGGCTCGCTACGGCATCCCACAATGTTGTTGCGTTAATTTGACCATTCCGTCCGACAAAAGC
GGTCGACATCAAGATATGGTGATCCCTGAATGTGCTATAAATCCGAATGCCCGAAGCTGATCAAGGCAATCTATAGTGTCAAATCCGGTTTGCATGAGTG
GAGTTAGATTATCGACGAGTACATGTTTTTATCCGAAGTATAAACTTTATCTCTACGTCAAGATTATGGACCCTCACTGCGTGACGAGAGTAGCATGTTT
GCGTCACACCGAATTCATGTACAGTATCGATGGTAATGTCAAGATATGTTTATGACGCTTTGTAGGCTACACATAAGCGCTTTGGCTCAAGATAATCCGA
GGCTGTAGTGATTTCGGCGGATCTAGGCTCTCGACTTGCTCCATGCAGCGGGCCAACCAAGGCGTACAATTGCACTCACAGGCTTGAAGACCGCGACACG
ATCAACCATCACTATCACTATAGGCTACTTATCACGAAAGTGGTTTATCTTTAATTCGAGCAATGGACCACGGCAAAGCGTAACGCTCACTATTTGTGAT
GGGCCAAGTCGCACGGCATCTGTTTCAAGCCCAATACATTCGTAGCTTCTTTGGCGCAAACTTGGTGGTGACCACTTCGACCGCAAGCCAACTCCAGGCT
CTACGTTTCTATTGCCCGATCCAGCGTTATTACTCTAAACCCAGAGATATACAAGTCGAATGATAAGACGAGTGTGGATTGGATGGCTTCAATGACAGCA
TGTGAAATATGTAGTGATGGCAGTATGTGCTGCGATAAATTCATCACTTCAACATTTCATTTCTGTCTACAAAAACTGGTTACAGAAGACGCTGAGATTT
TAAGAATACGCCACCCGAAGCAGAATCCAGTGAGGAAATATTTATATATTCTAGCATTAGTGTTTAAGATGTAGAGAACCAGTACACTATGG