Description :
From Genome Similarity Track
Location :
Scaffold_26:337841- 340456
Transcript NameFunction/comments
Aphas_H257_10608ATP-binding Cassette (ABC) Superfamily

Sequence
2615 bases(100 bases per row)
GGTGACATTGCGTTGGAACACGTCGAGTTTGCGTATCCGTCTCGACCCCATGTCAAGGTGTGTGCAGGGTATTCGCTCGTGGTTCCGGCGGGCCAGACGC
TGGCGTTGGTCGGAGCCAGTGGCAGCGGCAAGTCGACTATCGTCGGGCTGCTGGAGCGCTTCTACGACCCCCTTGGTGGCCGCGTGTTGTTGGACGGTCA
CGATTTGAAGACGTTGAACGTGCAGTGGCTGCGCACGCAGTTTGGGCTTGTGGGGCAAGAGCCAACGTTGTTCGCTGACACCATCGCCGGCAACATCCGC
CACGGCCGACCCGACGCGAGCTTGGACGATGTCATCCAAGCTGCCAAGCAGGCGAATGCATACGACTTCATCGTGGGTTTCCCCCTCGGGTTTGACACCC
CCGTGGGCCACCAAGGCGCGCAAATGAGCGGCGGGCAGAAGCAACGCATTGCCATCGCCCGGGCGATCATCAAGAACCCCGCCGTGTTGCTCCTCGACGA
AGCCACCAGTGCGCTCGACACGGAAAGCGAGCGGGTCGTGCAAGCGTCGCTGGACCGCCTGGTTGCGATGCGAAAACGCACGACGATCGTCATTGCCCAT
CGCCTGTCGACCATTCGGCACGCGGATCGAATTGTCGTGCTCGAAACTGGCCGAGTGGTCGAAGACGGTACCCACGACAGCCTCGTGCAGCTCGAGCATG
GCTTGTACCACGCGTTGGTTCAGGCTCAAGAGCGCCGTGCGTCCCCCTCGATCGACCAACGCCAGTCCCTCAACGTCCGCACAATTCCGTCAAAGGAAGC
GTCCGTTGTGGCTCCTTCCTCTGGGGAGACAAATCATGACGGCAAGAACACCATCGTGGGGGCTATAACTAGTAGTGCAAATGCGTCGATATCCGGCTGC
AACGACGATGAGAACACGACAACTGAGCCGGTGCCAATCTCGAGGGTGTGGCGGCTAAGTGCCCCGGAATGGTGGCATGTGCTTCTTGGGAGCGTGGGGG
CGATCCTGCACGGCAGTTTGTACCCAGTGTGGGGGGTCATCCTCACAAAATGCACGTTGGTGTTCTTCCAAGTAAACCTCGGCATCGACGGTATGCGGTC
GGAGTCGCTCAAGTGGTCGATGGGGTTTGTGGGTCTAGGGGTCGCCATGTTGATTGCCGTGACAATTCAAAAGCATCAGTTCTCAATCGTGTGCGAAAGA
CTGACCACACGCATTCGAGTCATGTGCTTTGGGGCCATGTTGCGTCAGGACATGGCGTGGTTCGACGACCCCCTCCACGCCCCGGGGGCCCTCACCACGT
GCTTGGCCACTGACTCCGCTGCCATCCAGACAATGACAGCCGAGACGTTAAACGCCATCTTACTCAATGCGTCGACGTTGGGGGTGGCGTTGGGGGTATC
GTTCTACTATAGCTGGCGGATGACGCTGGTGTTTATGGCCGTGATTCCGCTCATGGGGGTCGCTGCCGCACTTCAAATGCAAATGGAGACGGCGCAAACT
GGCAAAGGGGGGGGAAACGATGGCGACATTCAAGCTGGGGCGGTGCTCAGCGAAGCCATCCACGCGATCCGGACCGTCGCATCGTTCAACCTCGAGCGCC
GGACGCAAGATGTGTACATGGCGCAGCTCCAACGAAGCGCAGCGTTGGATCGAAGGGCGGGGTACAGAGGGGGTGTCGCGTACTCGGTGGCCCAGTCGTC
GGTGCTGTTTGCGATCGCCGCCGTGTTTTACTATGGGGGGTATCTCGTCCGGCAGTCGCTTCTGGACTTTGAAGGCATGTTTATGGTTCTCAACTCGATC
TTGTTTTGCTCGTTTGGCGTGGGGATGGCGGCGCAAGCGCTGGGGGATATCAGAAGTGCCAGAAAGTCCATCACGCGTATCTTTTCTATTGTTGACCAAC
AACAGACTATCGACACCGACTCGACGACCGGACTCGTTCTGTCGCATGTTGATGGCGTCGTCGAGTTTAAAAACGTCGCGTTCAGCTACCCCAGTCGACA
GCAAAGTGCCATATACACGAATTATTCGCTCAAAATCGAAGCGGGGCAGACGGTGGCGTTGGTGGGGGGGAGCGGCAGCGGCAAGAGCACAGCCATCAAC
CTCATCGAGCGGTTCTACGACCCCACGGCGGGCTCCGTCACACTCGACGGACACGACATCACAACGATTAACTTGCACTCGCTGCGCAGCCACATTTCCC
TCGTGAGCCAAGAGCCCGTGCTATTTAGCGGTACCATTGGAAGCAACATTGCCATGGGCAAGCGAGGGGCCACCCAGGCGGACATTGAAGACGCAGCCAC
GAAAGCCAACGCGCACAACTTTATCCTTCAGTTTCCGGACGGGTATGACACGCCTGTGGGGGATCGGGGGGTCCAGGTGTCTGGGGGGCAAAAGCAGCGC
ATCGCCCTCGCCCGCGCCATCATTCGCGATCCAGCCATCTTGCTGTTGGACGAAGCCACGAGTGCCTTAGACAACGAAAGCGAGCGCATCGTCCAAGCGT
CATTGGATCAACTTTTGCAGATGAAACGCCGCACGACCATCGTTGTGGCCCATCGGCTGTCGACCATTCGACATGCCGACGTGATTGCCGTCGTGGACGG
AGGCGGGATCGCAGA