Description :
From Genome Similarity Track
Location :
Scaffold_29:33780- 38062
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.10Glucan 1,3-beta-glucosidase
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.11General transcription factor IIH subunit
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.12Tryptophan synthase

Sequence
4282 bases(100 bases per row)
GCCAACTGTCTCTCGCCCTCTCATTCGATGCCTCATTCGCGCATTTGCATCCTTCCAGCAACAAGCTCTCGTCTCACCCGCCCTCTCTCTCTCACTCTCT
CTCAAGATGCTCACGCGCGTAGTGCTCTCTGCGGCCACCGTGGCGTCGGCGCTGCTGCTGGCGACCACGAGCGCGCTCGACCAGAGCCTCTACGGCATCA
ACTACGACCTGCGCCAGGGCCCCGACTGGGATCCGAGCAAGTGCAAGTCCGCGGCCACGATCGCTGCCGACCTCAAGGTGCTCAAGACCATCACGACCAA
CGTGCGTACGTACTCGCTCTCGGACTGTGACGTCGCGCCCCTGCTCACGGCCGCCAAGTCGCTCGGCCTCACCGTCTGGCTCGGCGTCTGGGTCTCGGCC
GACACGTCCGTGTACGACAGCGAGGTCGCCGCGCTCAAGAAGCTCATCCAGGCCAAGCTCATCGACTCCAACGTCGTGGGCTTCAACGTCGGCAGCGAAG
CTGTTTATCGCAAGGACATCACGGCGGAGAAGTCGATCGAGTACCTCAAGGACTTCAAGAGCGTGCTCACAAAGAACAGCATCACGGCGCCCGTGTCCAT
CACGGACATCGTCGACATCCTCACGCAGTACCCCGACATGATCGCTGCCGGCGACGTCGTCACGACCAACCAGTTCCCGTTCTGGGAAAAGATGGAGCCA
TCGAAGGCTGTTGCCCAGTTCAAGACCCGTATCCAGCCGCTGATCAACCTGGCGGCCGGCAAGGAGTTGATTATCAGTGAGACTGGCTGGTCCACTGGTG
GCAAGAGCGCCAACGCATCGGCTGCGACCCCCGAAGGCGCTGCGGTACGTCTTCGTGTATTTCTTTTCGCCCTGCATGACTTGAATGGCTTATTTAATCG
GGGGTTGTTTGCACTCTAGCGCTACCTGAACGACTTCTACCTCCTCGCGAAGGCGGAGGGCTGGAAGTACTACTACTTCTCGGGCTTCGACACCCCGTAC
AAGGCGGAACAGATGCAGGAGCCAGACACGGTCGAGGTCTATTTTGGTCTCTTTGGCACGGATGGCAAGATGAAGAGCGCGTACTCCGACCTCAAGATCG
CCAAGATCGCGACCACGGAGAGCACTAGCGGAAGCACCACCGGCACCTCAGGTACGGATTCGTCTTCTCCATCAGCGGGCACTGGTACCGATTCGACTAC
TGGCAAGGCCACCTCGGGTGGTATGTGACGACGCATCCATCGGTTGCACAAGTGCAATATGGGAAATTGGTTCCTAACATCCTATTTTGTGTTATTCCTG
AATGAAATTTAGGCACGACTGATTCCACGTCCACTTCTCCTGGTTCAGTTCACGCCGGCGCCTCGAGCTCTGTTGGCACTGGCGCCGTCTCCAAGAGCAA
CTCGAGCTCGTCCTCGTCCGCGAAGAACGGCACCAGCGCGAACACGACGAGCGCTTCGTCGCCACTCGCGACCGCGGGCCTCACTGCCTGTGCCGCGATC
ATCTCTGCTGTCTTCATGAGCCTGTAAACGTGGTGACTGACCGTCGGTTGAAGAGCGTTGGCCAAGTTGTCTCGGTATACCGAGCTGATTTTTTCCCTTC
ATGTCCTCGCATGTTTTTTGAACGAGAGAAAGGTTTCATAACCTACAATAAGACGCATCCTAGACTAAACCTAAAATAAGACGTGATGTGCACCCCTTTC
CCCTATTAATATAGGAGATATATACTATATCTCGCATCGGATCTGTCCGACGTTTTGGATTGAAAAAGCCCACAAACGCAAAAAGCTGCTGCACTAACAT
GGAGGAGAACAATGGCGAGGTCGGGACGTCGCTGGCGGCGCGGATAAACAGCGCGGCGGGTCCGCAGCAGATCGATGTCGTGAACGAAGGTCTGCTCGTG
CTCGTGATCGACACAAACCCGCTTTTCTGGTTCGCCGATGGCCAGCAGCGCGGTCACAGCGGCAGCGACTTCCAGCAGCTCGTCGCGAGCACGCTCGTGT
TTGTCAACTCGTATCTGCTGCTGCACCGCAGCAACCGTATCGTGATCGTCGCTGCGCATGCGGGCAGAGCCGAGATGCTGTACCCGGATCCGGACCAGGA
GGACACGTCGGGCAGCGCCGAGCAGTCGGCCAAGGTGAACGCGAACGTGATGAAGAAGCTGCAGGCTCTCAGCGAGCTGCCGCTCGACCCGGCGAAGCCC
AATGCGACTGCGATCGCAGCCTCTCTCTCCAGATCTCTGTGCTGTAAGTGAATGTATATGAGTGTAAGCGCTAGAGTGGCGAGTAAGGTGCTGATATTGT
TATGATGCTGTTTATTGAATAGTTATCAACCGCGCCATCCGCGAGCAAAGCGATCTTCGTCCGCGCATCCTGGTGATCCAGAAGTCGCCCGACGTGTCGC
AGCACTACATCTCGATCATGAACGGGATCTTCTCAGCGCAGAAGAAGAGCGTGGCGGTCGACGCGTGCATCCTCGCCAGCGAGCACTCGTCGTTCATGCA
GCAGGCTGCGTACCTCACGGGTGGCATCTACTACAAGCCGCAGGACCACAGCGGACTACTCCAGTACTTGCTGTCGATCTACCTGCCGGACCCGAGCATG
CGCAAGCTGCTGAAGCTACCAAGCCAGGACTCGGTGGACTTCCGCGCGATGTGCTTTTGCCACAAGGAGGTGATCTCGACGGCGTTCGTGTGTCCCGTGT
GCCTCTCGCTCTTCTGCGAGTTCCAGCCGATCTGTTCGACCTGCGGCATCCGCAGCCGCATCCAGCCGGCCAAGAAGCTCCAGCAGAAGAAGCGTCTGCG
TCCAACGTAGCAAGCTAGCTCTTCAGGATCGCACGCTCTCATGATAGATTGCTTTACGGTAGTTCGTTGATATCCGAATTTGGGTATTTACGGTTTGAGA
CAGGTGTCGCAAAGAACCAAGGCACAATTATTTTAGCCAATCATCGCAAAGAACCAAGGCACTATTATTTTGGGTTGGTAGGTACATTTGACTTGAGTGG
AAATTGTAGTATATTTATAAAAGCTACAATCCCACAAGTCAAGTTAAATGTACCTGTCCCTTTTCTGATTGGCTGTAAAATATCGCCAACACTCACCAAA
ATACGAACTTTGGGCTCTCAGATTTACTAATTTGGGTTCCTAGAGAGCTGTGTTACAAAGCATCGTGATGCAAACAGAGGTGGCATTCCTGAACAAGCCG
CGTCCTGAGCACATCGAACCCCAGCAAGCAGCACCATGACCGGCAGCAGGTGAGGAAGCACGGCGTTCGTAGTGCGTTAATGTGTCACTCACTGTACGTG
CATCTAACTGTCCTCTCGTCTAGAAAAACCATCGCGCAGACCTTCGAGGACGCCAAGGCGGCCAAGACCGCGGCCTTCATCACGTTCACCGCGTGCGGCT
TCAAGACCAAGGCGGACACGGTCGAGATCCTCCTGGCGCTCCAGCGTGGCGGCGCTGACATCATCGAACTCGGCGTCCCGTACTCGGACCCGCAGGCCGA
TGGCCCTACGATCCAGCGCGCACACCAGATCGGCGTGGACCAGGGCATCACGCTCCGCGACGTGCTCGACACGGCCAAGGAGGCGCGCGGCAAGGGACTC
ACAGTGCCGCTCGTGCTCATGGGCTACTACAACAACGTCATGCAGTACGGCGAAGGCAAGCTCTGCAAGGACGCTCACGAAGGTAAGCTACCTGACTCTC
TGGTGATTTGTGGAATTGTCACAGCTCGCTTACAATGCTTTGATGTCGTCATGTGCGCATATTAGCTGGCGTCGACGGCTTCATCATCGTCGATCTGCCG
CCCGAGGAGGCCAAGTTCCTCAGCAGTGAAGCGAAGAGCTACGGTATCGCGTACATCCCACTGATCTCGCCCACGACCACGGACAGCCGCATGCGCATCA
TCGCGTCGGTCGCGCACGGCTTCGTGTACTGCGTGAGTCTGACTGGCGTCACGGGCGAGCGCTCGGAGCTGCCGCCGAACCTCGAAGCGTTCATGGACAG
GAGTGAGTGTGGTGCATTTTTATGCTGTTGCCTATCCGCGTGAGTTCTAACGTGTGTCTGTCTGTTCTTTCATGTGCTAGTTCGCTCGAATGTGTCGTTG
CCACTGGCGCTGGGCTTTGGTCTGTCGTCGCGCGACCACTTCCTGCAAGCCAGCGCGCTCGCCGACGGTGTCGTCATGGGCTCGAAGATCATCCAGGTCA
TCGAGAAGTCTGAGGACAACACTGTCAGCCGTGCCGCCAACGTCGAGGCGTTCTGTAAGAGCATCGTGAACCCGTAAACAGC