Description :
From Genome Similarity Track
Location :
Scaffold_273:3378- 4548
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_273-fgenesh-gene-0.0Endo-beta-1,6-galactanase

Sequence
1170 bases(100 bases per row)
GCCTACACGGTCACGGTCACGCCCAGCAAGACGCTCATGACGTGGGAAGGATGGGGCACGTCGCTCGCGTGGTGGGCCAACGTCTTTGGTGCGCGCGCCG
ACGTCGCCGACGCGCTCTTCTCGACCAAGGACGCGGTCGCCGTCAAGGGCGTCGACGCGCCCGTGCCCGGTCTCGGCTTCAACATCCTCCGCTACAACGT
GGGCGGCACGAGCAAGAACTCGATCGACGACAGCGGTAAGAAGCGCACCATGAAGGCGTCGTCCAAGATGCCGGCGTTCAAGGAGATTGAGAGCTACTGG
ATCGACTGGTTCAGCAAGGACCCGGCCTCGACGAGCTGGAACTGGAAGGCCGACGCGACGCAGCGCTCCATGATGACGCTCGCTAAGGCACGCGGCGCCA
ACATTTTCGAGGCGTTTTCCAACTCGCCGCCGTGGTGGATGACCAACAACGGCGCCGTGGCCGGTGCGGACAACGGCAAGAACGACAATCTCCAGACGTG
GAACCACGACGACTTTGCGCTCTACATGGCCACGGTCGCCAAGCACGCCAAGGACAACTGGGGCATCACGTTCAACTACGTCGAGCCGTTCAACGAGCCC
ATGGCCACGTGGTGGACCTTTCCCGGCACGCAGGAAGGATGCCACTTCTCCACGGCCTCGCAGCAGTCCGTGCTGGTCTCGCTGCGCAAGCACTTGGACG
CACTCGGGCTCAAGACCATGGCCATCACGGCGTCGGATGAGAACTCGGTCGACGTCGCCCTGACTTCGCTCCAAGCACTCTCGGCCAACGCGTCGGCCAT
GGGCACCGTCACCAAGATCAACACGCACGGCTACGACGGGCTCAAGCCGTACCGTGGCAAGAACCGCGTGCCGCTCCACGACCTTGTCAAGAAGCTTGGT
AAGTCGCTGTGGGACTCGGAGTATGGCGAGGACGACGCCTCGGGCTTGAGCATGGCCGAGTCGATCGGGCTCGACATTAACGAGCTCGGGGTCTCGGCCT
TTGTGTACTGGCAGGCGCTGGATGGTGGTGCGTGGGGCCTGCTGCAGTCCAACCCGGGCGACAACTGGATCGGGCAGCCCAACGGCAAGTACCACGTCCT
GGCCCAGTACTCGCGCCACATTCGCCAGGGCATGACCATCGTCTCGTCCAGCGACAAGAAGACTGTGGTC