Description :
From Genome Similarity Track
Location :
Scaffold_33:337770- 340067
Transcript NameFunction/comments
Hyaar_Emoy2804955ATP-citrate synthase

Sequence
2297 bases(100 bases per row)
AGTAAATCGAACGAGGTTAAGCCATCTGTGGATGATAATAGCGGTGTGAATAGTGATAACGAGGAAAGCGGATCTGCTGAAGGGCTGGAGAGCAAGGGAG
TTGCAACTGCGCAGCCTCCATTGGTAATCCAGGATGAAGGCATTGTGCGCATGGACGACAAGACGCGTTGTATCGTCTACGGGCTGCAGCAGCGTGCCGT
GCAGGGTATGCTCGATTTTGACTACCTGTGTAAGCGCAAGACCCCGAGTGTGGCAGCCCTCGTCTTCCCGTTCTCACCCAACCACTACCTGAAGTTCTAC
TGGGGTACTTCAGAGCGTCTGATTCCCGTCTTCCAAAAGCTGTCTGATGCTGTCAAGAAGTATCCGGACGTGAGCGTGCTGATCAACTTTTCATCATTTC
GGTCTGTGTACCAGTCGACGATGGAGGGATTTGAGCACAGCGACACCATCAAGACACACGCGATCATTGCCGAGGGTGTTCCAGAGCAGCAGTCGCGTTT
GATTGCGAAGAAGGCTCGTGAACTGAACGTGGGTCTTATCGGTCCTGCCACGGTTGGTGGCATCAAGCCTGGCTGTCTGCGTATCGGTAACACAGGTGGT
ATGCTGGACAACATTGTGCAGTCAAAGTTGTACCGTCCTGGCAGTGTGGCATACGTGTCCAAATCAGGTGGTATGTCTAACGAGCTGAACAACATTGTCT
CGCAGACAACGGATGGTGTGTACGAAGGTGTGGCCATTGGCGGTGACAAGTACCCGGGCTCCACGTTCATCCAGCACCTGCTGCGCTATGAGGCGAACCC
GGAGGTCAAGATGATGGTTCTTCTTGGTGAAGTCGGTGGCACTGACGAGTTTGCTGTTTGCCGTGCCATACAATCGGGTGCCATCAAGAAACCGGTGATC
GCCTGGTGCATTGGTACGTGTGCGAAGATCTTTCCGTTTGAGGTGCAGTTCGGTCACGCCGGTGCTTGCGCTACGGGTGAGTCCGAGACTGCTTCGGCTA
AGAACGCTGCTCTGGCTGCTGCGGGCGCTATCGTTCCAAAAAACTTTGATCAGTTCGGCAGCGCGATTCGCAAGCAATTTGACTCGATGGTCGCGTCGGG
TGTGATCGTGCCGCGTCCGGAGGTTCCGGTCCCTAAGGTTCCTATGGATTATGCCTGGGCGAAAAACCTCGGCCTCATTCGTAAACCGGCGAACTTTATC
TCGTCCATTTCGGATGACCGTGGCGAAGAACTGCGGTATGCTGGGACTCCCATCTCGAAGGTGTTTGAGCAAGACATGGGCGTTGGCGGCGTGATCGGTC
TTCTGTGGTTCAAGCGCAACCTGCCGCCCTATGCCTCAAAGTTCATTGAGATGGTACTTATGGTTACGGCTGACCACGGCCCAGCTGTGTCGGGTGCCCA
CAACACGATCGTCACGGCCCGCGCCGGCAAGGATCTGATCTCTTCGCTGATTTCGGGTCTAGTGACGATTGGTCCCCGCTTCGGTGGTGCTTTGGACAAG
GCTGCCGAAATGTTTGCGAGCGCGCACGACTCGGGTATGTCCGCAGCTGATTTTGTGAGTGAAATGCGCAAGCAGAACAAGCTAATTATGGGCATTGGCC
ACCGCATCAAGTCGTTGTCGAACCCGGACAAGCGAGTTACGATCATCAAGGACTTTGCCAAGGCGAACTTCCCTGCCACTGATGTGCTGGACTTTGCATT
GAAGGTGGAGCAGGTGACCACGAAGAAGCGCAGCAATCTTATTCTGAACGTGGACGGTTGTATCGCAGTCTGCTTTGTGGATTTGCTGCGCAACTGTGGT
GTATTCACGCTCGAGGAGGCCAACGAGCAGATTGAGAACGGCTGCCTCAACGGGCTGTTTGTGCTCGGTCGTAGTATTGGTTTTATCGGCCATTTCCTCG
ACCAGAAGCGTCTCAAGCAGCCGCTCTATCGCCATCCGTGGGACGACATTTCGTACCTGAACGAGGAGCTCTAGATACGAGTATATTAACTCGTGTATTA
CGCGTCAAAGTGGACGCTAAGCAGTAACTTCTGACATGTGTGTTCTTATGGTATGAATCGTTTCGTGGCTCGTGTTTGATGAAGTAGGTAGCGCTACCAC
TTTATGCGCACCAATGCGTCTGGTATCGCTAATTTAGCTTCAAGTCTCAGCTTATGCTGCATGCCTTCGAATTGTTTCAGAAATGACCATTGTAGTCCAA
AAAGAGGGAAATGTCGGACTGGAAACGTATTTGGACCAAGGAGAGCTAGAACAATACCACGTGTCTCGCTAATGATCGTCTACAAAGCTAATGTCTT