Description :
From Genome Similarity Track
Location :
contig_39:337726- 338760
Transcript NameFunction/comments
g8585.t1RAW31213.1 hypothetical protein PC110_g12423 [Phytophthora cactorum
g8586.t1hypothetical protein
g8587.t1hypothetical protein

Sequence
1034 bases(100 bases per row)
GAAGTTGACGTTCGCAGACGACGACGAGAACTACGTGCCCGAAGACACTGGAGACAGCGGAGGCGACGCGCTCGACTCGTTCCAGCTTGGTCTAGAAGGA
GAGGAGGACGACGACGAGCCCACGGCCAACACGAGCAATAGGAAGCGCTCGAAAAAGGTCAAATTCTAGAACTCAAGCACGTTTTTCATGAATCCATGTA
TGGCATTTACCACAGAGTCTCTACTCGGTCTTCTTCTGGCTCTTGAAGTCGTCTGGGTTGATGTTGTGCTGCCGCAGTAGCTCGTTGAACTCTTCGTCGT
ACTTGTCCGTCTCGGGGTCGGCTACGCGCGGGCCGTGGTCCGGGTACTTGTCCTTGTAGCGCCGGAGCATGCTAGTGTGCAACTCGTTCCAGCTCACGCT
GTCGTCCTCTGTCTCCTTGTCCTTCTTGTCCTGCAGCTCCTTCTCCACCTTGCGCAGGCCGTCGAACAGCTCCTGGGTCGGGTTCGCGCTCTTCTTCTTG
GACTGTTTGGCGCCCAGAGGCACGAGGCGGTCCCCGTCCGTTACGAGCTCCTCCATCTGCTCCTCTTCCTCCTCGGACGAACTGTCGCGGATCAGCTCCG
TGGACAACGTCGGCCGCTGCGTCTCCAGCTCCTGCGCTTCCGCCTCGTTGTCGATCTGCCGGTTGAGCCAGCGCGCTCCCAGGAACAGGACCAGCAACGC
CACATAGTACTTGAACACGGGCGCAAGGACGCTGGCAAAATCCCACAGCGAGCGCGGCGCTGACGGCAGCTCCAGCTTGTCTACAACTTCGTACTCGTCC
ATCGCAGCAGATACTGAACTTGTCCAACACGTCATCAAAAGTGTAGCCATGTAGAAATGATGTTCCATACACAAACCTCTCTATCTAGCTACTACGAAAT
GGCGGATGGTGTACAGACTGTACTACAGTCCACCAACCCCTCTCTATCCAGATACTCGACGCCATTTCTACAGTCTCGAAGGATGGGTAACCAGCCGTCG
ACCAAGACGCCGCGGCGCGGCCGATGCTGCACGA