Description :
From Genome Similarity Track
Location :
contig_39:337702- 338736
Transcript NameFunction/comments
g8213.t1RAW31213.1 hypothetical protein PC110_g12423 [Phytophthora cactorum
g8214.t1hypothetical protein

Sequence
1034 bases(100 bases per row)
TACGTGCCCGAAGACACTGGAGACAGCGGAGGCGACGCGCTCGACTCGTTCCAGCTTGGTCTAGAAGGAGAGGAGGACGACGACGAGCCCACGGCCAACA
CGAGCAATAGGAAGCGCTCGAAAAAGGTCAAATTCTAGAACTCAAGCACGTTTTTCATGAATCCATGTATGGCATTTACCACTGAGTCTCTACTCGGTCT
TCTTCTGGCTCTTGAAGTCGTCTGGGTTGATGTTGTGCTGTCGCAGTAGCTCGTTGAACTCTTCGTCGTACTTGTCCGTCTCGGGGTCGGCTACGCGCGG
GCCGTGGTCCGGGTACTTGTCCTTGTAGCGCCGGAGCATGCTAGTGTGCAACTCGTTCCAGCTCACGCTGTCGTCCTCTGTCTCCTTGTCCTTCTTGTCC
TGCAGCTCCTTCTCCACCTTGCGCAGGCCGTCGAACAGCTCCTGGGTCGGGTTCGCGCTCTTCTTCTTGGACTGTTTGGCGCCCAGAGGCACGAGGCGGT
CCCCGTCCGTTACGAGCTCCTCCATCTGCTCCTCTTCCTCCTCGGACGAACTGTCGCGGATCAGCTCCGTGGACAACGTCGGCCGCTGCGTCTCCAGCTC
CTGCGCTTCCGCCTCGTTGTCGATCTGCCGGTTGAGCCAGCGCGCTCCCAGGAACAGGACCAGCAACGCCACATAGTACTTGAACACGGGCGCAAGGACG
CTGGCAAAATCCCACAGCGAGCGCGGCGCTGACGGCAGCTCCAGCTTGTCTACAACTTCGTACTCGTCCATCGCAGCAGATACTGAACTTGTCCAACACG
TCATCAAAAGTGTAGCCATGTAGAAATGATGTTCCATACACAAACCTCTCTATCTAGCTACTACGAAATGGCGGATGGTGTACAGACTGTACTACAGTCC
ACCAACCCCTCTCTATCCAGATACTCGACGCCATTTCTACAGTCTCGAAGGATGGGTAACCAGCCGTCGACCAAGACGCCGCGGCGCGGCCGATGCTGCA
CGACGGCCGCAACGCGCGCGTGCTGGACCTGCCG