Description :
From Genome Similarity Track
Location :
Scaffold_18:3377- 5572
Transcript NameFunction/comments
Phyke_g2666hypothetical protein PHYSODRAFT_305050
Phyke_g2667hypothetical protein PHYSODRAFT_347744

Sequence
2195 bases(100 bases per row)
GCAGCAGGAATTGAAATAGCGCTTCGACGTGGACCCAAACCATCGATCGGAGCTAATGACATTGACTTTTGTGCATAAGCATCGGAGACCAACATGAAGC
CAGGTCTGAAATTTAGCGGTAGCGAAGGTCTATCGATGGGGAATTACCCTTAAAGTTGACAATACAACAGTAAGTAGATTGGTACAATATCCACTGACTT
TCTTGTCCGGCGGTTCCCACACGACATGAATACGGTCAATCCCATTTCGATCGTCTCCATTTTCATCTTCGCGCGCTTTGTAGGTATTGGTTACTGCCTT
CGGTAAGGTTTTAACAGAAGGCATAAGGCCTTATGGCAGACTGAATCTTGCAAGGATATCATTGTTCAGCTAGACGTACGATGCCTATGATAGGCTTGGC
TGTTGTGGGTGGCAACAGTTTCTGCTGAATGACTGCTGAGCCCCGGCCTAGTCAAAGCAAAGTCGCGCTGCAAAAGTTTTATGCAGTCGCACCGTCGGCA
ACTGCTACTCACTTGATTTATGCCAACACGGAACATCACTTCATCCGTTCGGGTTGATGGTGCACGAACAACGCTCGTCACGAGGTCGGTCGGTGCTGTA
ATCGGAAATGCAAGTCTCAATTATATCACTCTAGCGATGACTACTCTTTAGACGCGGGACCCATATCTGCAGAGTACAGTCGACCTGTCAAGTTCAACAA
GACCGACTTCGACGTCTCAGCGGCGCTGGGAATTTCATCCTGGAATATATGTCGTCAAAGAGGCCGCCGAATTGCATTACCGCATGATCGAATATGCACG
CATTACCACGAGACTAAATGGATTAATCTGGTGCGTGTACCGCATTGCACCAGCAAGTTATGGATAGCCTACGTATTGACTCGATAGTATCTATCTAAGG
CGTATCGAGTCGATACAGTGCGGTGCGCGATATCTTCAAGGTGCAGGCGGTGCTAATGGAAACAACTGACTGGTTGAAGCttggcaagcagcagcaatag
acGTGCCACTGTTGTCTGGAATAAGTGTCGGCAACGGTTGAAAAAATCCTTGACAGCGAGTCGCTGTAGTACAGCCGTTTGCTGAGCGGGGCTGCTCTGC
GCAAATAAATCAAGTGGATCCGACTCAGTGCGAGTGCAACAGCTCTCAACGCACACTAAGGTTCAACCAGGCAGCGTGAGCTCTAAATGACCGAGTTACG
GCACTGCATGGTGCTGTCGTTGACATTGTCTAGAGATCAATGGTCTCGCTGACGCTACTAGAGACGTCCGCAGTTTTACGTGTTGGTTTGTGCGGACTAG
TGCTGTACCTGTTGACTCCTTATCGACTCCCGAAGAGTGTCCGTTTCCAAGCTACATTGTCCATCATCACCTCTGAGATGCACATCATACCGTACATAAC
TTCAGCAAACGAAGATATCGTTCTGTACGATGAATGCTGGCGCGGATTCCTTCGGCTTTTTGATGCTTTACATGTATTGTCGACCATGCTCTCTCTCTCA
AGCGTCCGAATACGCGAGCCGCCTAGTGTCCATCCATATCAATTGGGCCTTACCGCGGTGGTAATTCATGGCATGTTTCCGATGATCTGCTTGAATTGGC
GTGACTATGCGAAATCTGGTCAAACAAATGACAACGGCTTGGGCGATATATCCGATCCTGTTGTAGTCACACATCCCCATGCTAGGGGGAAATAAATCAA
GTGAGGCCCACCGCGGGTCATCTCGGCGGGCATTCGTTGAcgtcgagctgcagcacgtcaaCCGAAGAGGTGAAGGTCGGGTGCAAAGACGGCCacgcag
cttcaacttctcaCTAACTTCAACATCATACTAATCGCTATTAATCACTACGCTTAACCGCTTGGCCGTTTGCCTATGGAGACTAGCGATCAAGTTGTGC
GTTTGGTCGCCGTCGAGTCAAGTCTTCATCCTTCATTCTCCAACTTTCTTCGCACTGAGCAAGTCAAGTCAAGTTTATCACAGTCTTTGACTTTTATCCA
GTGAGTATGAGCACCCAAGTCGACGACAACGTCCCGACCGAAGGCAACCGCACGTACGCCATCGTCGTATGTGTCTTTGCGGCTCTCGGTGGTCTCTTCT
TCGGCTATGACCAAGGTGTGACCTCAGGTGTGCTCATCATGGATTCCTTCATCTATGACTACTGTGTCGGCTGGCACAACTTTACGTACGACCAG