Description :
From Genome Similarity Track
Location :
Scaffold_719:3377- 4707
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_719-fgenesh-gene-0.2Acyltransferase WS/DGAT/MGAT family protein

Sequence
1330 bases(100 bases per row)
ACAGCCACCGAGATGCGCGACGTCGTGAGCTGGAGCAGCGGCTTCATGACCCACGCCGGCAGGTACGCGAGCACGTGGCTCGACCAGTAGGTAAAGAATT
TTTCCAGCGAGTGCTTGGCTTCGTTCATGTTGCGGCGGATGCGCGCGAGCCGCTGCGCCGGGTCTGCAACGCCAATGGGGAAGTCGATCACGAGCGCCGA
AAACTTGTTGCGGGCATCCGTGACAACTTCGTCTGTGCCACGCATGTCGACAGGGATCGCCGCCCGCACCGTGAGCGACGGCGCGACCTCTTCGCCCTTC
GCGACCAGTGCGCGCCGCATCGCGCCGGCCACACAGCTCAACATCACATCGTTGACGGTCGCGTGAAAGTGCTTGCCGACGCGCTTGGTCTCGGCCACGC
TGTACGTCATGTGGTGCGACAGCTTCTTGCGCGTGCCGCCCGTTCGCTTGAACAGCGTCGCCGGCTCGGCGCGCAGCAGCATCGTCACGAGCTTGCGCTG
CACGACGTACATCGACCAGACACAGAGCGCACCGAACTGGGCGAGGCTCGTAACCTTGGTGGCGAGGGACGTGGGCGATTTCGGTGCGCTCTTTTTCGCC
TGCTGGTGCTTGGCGATCATCTCGTCGAACTGCACTTTGTTGTCGCTCAGGCGGATGAGCGCGACCGCGAGGGACTGGCCGTCGCCAATGCAGTGGTGCA
CTTTCCACGCGCAGTACGTCACGTCCTCCGTGGGCGCGTCCGAGACCATGACGTGCATCTCCCAGAGCGGCTTGTTAAAGTCGAGCGGCTGGTTCGTGAT
CGACTCCAAGTACGAAATGGGCGTCTCGCCCTCGCGCAGCTTGTGGGTCGTCACGTGGCGCGAGACGTCGAAGTCGGCCAGCTCGACAAACTCTTTCTCG
TCGTTCACGACGAGCGACCGGAACCGCCGGAAAAAGTCGTCGTTCACCATGCGCTCCTGCAGGCGCGCCGTGAACTCTTCCACACTGATCGTGCCTTCCA
CTGAGAGCAGGCTCACGGGGATCGACAGGTTCGTCTCGGTCTCCGTGACCAGCGTCGAGATGCCAATGTTCGACATCTTGCGGCGCAGCGCGCGCTTGCC
ATTGTCGCGTGCCTCGCGTTCGCGCTTGCGCTGCGCGGACGCGGCCTGAAGCGCGAGCAAGAGGAGGCTCGCGACCACGACAAGCAGCACCGTCGACGAG
CTCAGCTCCACGCCGTTCGCGAAGAGCTGCGCGAGCGAAGCCATGGGGTCTGGAGGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGA