Description :
From Genome Similarity Track
Location :
Scaffold_207:33763- 35290
Sequence
1527 bases(100 bases per row)
AAGCGTTCCAACAAGGTTACGCGTCCGACCCTGTATTCAAGCAACAGTGGTCGAAGGGGACAGACACTGAGAAGTTCGTAAAGCATAATGATCTTCTGTT
CTTCAAACAGAAGCAAGGAGAATCTGTCTACAGATTGTGTGTGCCCAAATCCGAGAAGCTTCGCACGGATGTCATCACAGAGTTTCACGATGGAAATACA
TCCGCGCATCCGGGAAGCAGGCGGACGTATCTAAAAGCAGCACAATGGTACTATTGGCCAACGATGGATCAAGATATCAGAGAGTATGTGCGTACTTGTG
AAACGTGCGCACGATGGAAGTCCAGCAGTCAGAGAAAGAAGGGTCTGCTGATACCAATTCCAGCACCATTGGAATGTTGGGAAGTGGTGTCCATGGACTT
TATTACGGGTTTACCAGCGTCAGAAGGGTACGATGCTATTTTCGTTGCTGTAGACAAGTTGTCTAAGCGTCCGAAATATGCACCGACCTATACGACTGCT
GATGCGAAGGATACAGCGGAAGTTTTCTTTAATGCTGTTGTCAGGCACCATGGATTACCGCAAGTGATTATTAGTGATCGAGATCCAAAATTTATCTCGG
ATTCTTGGAAGTCACTAATGACACTGATGGGTGTCAAACTGAGTATGACTACGGCTCATCGAGCTCAAGCCGATGGCCAGACAGAGCGTCAGAACCTAGT
GCTCGAAGATGCGCTGAGATGCATGGTGTCATATCATGGAGATGATTGGGTGAAGCATCTCGGAACGATTGAGTATGCTCATTCAACATTGGTAAACGCG
TCGACTAAATTGACTCCATTTGAAGTCGACACAGGCCGCAAAGTTTCTAACGTTGTGGCAGAAGAGATGAAGGATTTATTGCGTAAAGAAGACGACGTCA
CACTGGCCGAGTACGCAAAGAACTTTGCTAAGAAACGACAGGAGATCGTAGAACGTGCTCAGAAGAATTTGAAAGAAGCACAAGACAGACAGAAGGAGTA
CTATGATCGCAAACGCAGGCAAGTGGTGTTCAAAGAAGGTGACCTAGTGTTACTTGATACGAAGAATTTACCACTCAAGACCGTCAACAAGAACACGGAG
CTAAAGAAGGCGAAGTTAGCTGCGAAGAAAGTCGGTCCGTTCGAGATTGAACGGATGATAAATGACAACGTGGCAAAGCTGAAACTACCGTTGTCAATGA
AGAGACTCAATCCGACGTTTAACGTGGAATTGTTGTCTCATTATCTGACGAACACTACTGACTTTCCCAATCGCCCGATTCCGAAAGCTGTACCATTGAT
CTTGGACGACGACACGGGAGAAGAGCTCTATATTATCGAGCGTTTTATCAAGAGAAGGACCAGACGCCACAAGCGAGAATGGCTCGTGCAGTGGCACGGG
TTGCCAAGACATGAGGCAACCTGGGAGTGCGAAGCGGATATCAAACACGTTTCGCATTGGCGTCAACTCCTGGGAGGGTTTAAATTCCGCCAAGGCGAGA
TCAGCCCGGGGGAGATGTCATACCCGC