Description :
From Genome Similarity Track
Location :
Scaffold_119:33760- 35190
Transcript NameFunction/comments
Phyra_84637reverse transcriptase

Sequence
1430 bases(100 bases per row)
TGTGACGGGCTTCCGTCACATGGTTGCCATCGCGTGTGTGCGACGGCCAATCAGCACTCTCCGCTGGTTGGGTGGACACGGCGCTCTCGGCACGAGAGCG
CCTTGATAACAATGAATCTCAGAGTTACTTTTCCCCTGTTTCCTGCGCTACAGTGTACGTCGGTAACGGGTTTGTATTAGCCCGTTACACCTGGTAGCAC
TTTGTGATCCGTCCAACGACCAAGATGAACGACACGTCCATGAGCGACGCGTCCACCCTCAGCGGGGCGACCGGGGTGTCGCTCGAGCACGCCAGCTTTC
CTCACCTGTCGCTGTTCGAGTGGGAGGCACTGCACAGGCTAGCCGCAGTGTCAGGTGACGGCGTCATTAGGACACTATTGACGGCCGGCACGGAAGAACA
ACAACGCCTGGCCGCCCAGGAGTTCATGGCGCGTGAGCTCACCGACCTCCGTCGGCGAGCGACGACTCCCACGCCGTCCACGACATCGTCAAGCTCGATG
TCTCCACATACAGCGGCGAAGGCAAGACCCGCCTTCACCTGAACCGTTGGTTCTGCGATGTGGACATAGCGATCGAAGCTCGGCAATTGTCTACCGAGCT
CGCGCGCACGCGCTTCCTGCTTTCCAAGTTATCCGTGAAGCCGAAGGAGTGGGCACTCGGCCGACTCGTGGCCAACGCCTCCTGCTTCCCGACGATGGCA
GCTATGCAAGCTGACCTGCGACTCGCGTTCGAGCCGCCCCAAGATGAAAGTGTCCAACGGTCAGCATTCCTTTCGCTAAAGCAGGGAGGTCTGTCCATGC
TCGAGTACATTCAACGCGCGCGCCATCTCGCCTCGTGCATCACGACGCAGCCAGTCGACATAACCACACAAGTCCACGTCTTTGTCTCCGGTATGAACGC
TGGCTACCAGCGCTTCTACTTGACCCGCAAGACGCCGTCGACGCTGGAGGAAGCCTTCACTATTGCGTTGCGTGAAGACTATAGTGTGTCGGCATCGCAA
GCTTTCGATGTCTCTCGGCCTCTTGTCCATGACCCAGAGCCCGAACCCATGGAGGTGGATGCTATCCAGTCCTATCGCGGACGTCGGGAGCCGACGTCGC
CTTCACGCTAATCCTCCACTCGTGGGTCGCGTCCTATGAAGTGTTTTCGCTGTGGCAAACCTGGTCATCGCGCGGCGGTGTGTCGTGCTCCGTCGCCCAT
GGTGGCGAGCGCCACGACTGTGAACGACGTCGCCGCTCCAAAAAACGGCGACGACCAGTAGGTGCGGGGCGCCCTACTGGGTGTGTACGGAGCGATGGTT
CTCTGGTGGCAGAACCTCCTCCTAGCCCTCCCGTGCTTCATGCACGCCTATCAGCCACCACATCTGGCAGTGACTCGAGACTGATCGTGCTCAGTCTCCA
CGTTGAAGGCGCACAGCGCCCAATACGTGC