Description :
From Genome Similarity Track
Location :
Scaffold_8:33758- 34977
Transcript NameFunction/comments
Aphas_H257_04868Hypothetical protein

Sequence
1219 bases(100 bases per row)
ATTGCTCTACTATGTTGTTGTCATTGGAACTCAACCCTATTAAGTATAATGTACACTCGGACAACAACTACACACACACCAAATGCAGGATTGATTTAAA
AATGCAAATATAAATTATATCAAGAATAGACGACCAATAATAATTTTTAAAAAATAAAAAAAAGATGGCTACGTCGAAGGCACGGCATCTCGTTATAGGA
GTACTAATACCTCGGATATGTCGAATAAATACATTGGGGGGGCTGCGGCAAACAGCGGCATCGCCAGCAAGTGTTCCACGGAACACGGTGAAACAGTCGA
GACACCAAATATACTCGCCAACACCTAGACATACTCGTTAACATGTTAGCAAGGATTGGAGGGTTGGGATTTTCTTTTGCTTTTTATTACGTTGGCAATG
TCGACAGGCAGTGCAGCAACATCCGACTCACGTGGCACCACAGCGTTCAATTCGCGTCCCACAGCCATTTCAAACAAAAAGTGTCTACAAAATTAAACCT
ATCACGTTAAATCGACAATAAATAGTATACAATACAATGGTGAATTTGGTATATATTTCCAAAACTCGAGTGGTTGGTCTAATCGTCTAATCACTATTGA
ATCACGCCTGGGTTCTGATGGGTTGAATATACTTGTCCTTTCTGCAAGAGCCAATCAAATCCACTCAAAATTGGACTAGCCAATAGCGTCGATTCGTGAT
TTGATTCAGCGGCGACATTCGATTCGACGGGGTCTGGAAATTCGTATCGAGTATACCACAATACTACTAAAGACTTGAAGTATGTATACGACACAAATAA
ACGAGTTCGATCGTGCATAAACTAACGGACTACACTACTTTAAAACATGTGACGAGAATACCACAGCATAGAGCACGCAACGGCATGACGGAAATATATA
TATATATTTTTTAAATCGTATGGCAGCATATACGAAACATATAATATTTTTCATCTGGCAGCACATATACAGTTCTTCCAACCTCACCATGGGAAACCAA
AAGTCCACGGAATATATTGTCCTTCTCACGCAAATTTGGACCATTTTGGAATGAACTTGGCAATATATGTTGTATTTAGTATAGTACAGTGAGTATATTC
TGCAACATATTGATTGGCTGAACCATTCAGAAATCTTGTAAATGGGGGGGTTATAATGGATTTCGATTGGCTAGTTCATTTAGAATGGATGATTTTGATT
GGCTAGTTCATTGTCAAAT