Description :
From Genome Similarity Track
Location :
Scaffold_13:337544- 344191
Transcript NameFunction/comments
g18382.t1XP_009528477.1 hypothetical protein PHYSODRAFT_301600 [Phytophthora sojae
g18383.t1XP_009528476.1 hypothetical protein PHYSODRAFT_506572 [Phytophthora sojae
g18384.t1hypothetical protein

Sequence
6647 bases(100 bases per row)
CTCTACGTTGAAGCCTGGCCAGCGTTGCGTCGTTATCCTGCCGGACTCGACGCGCAACTATATGTCCAAGTTCTTGAACGACGCGTGGATGTACGAAAAC
AAGTACGTGGAGAACACGGTGCACACGCGTGAAAACTACTCGAAGTACCGCAAGGAGACCGGCACGTGGTGGTCGGAGCAGCCTGTGTCTGTGTTGGAGC
TGCCGCACCCGTCGACGGTGGCCCCGCACCTTTCGTGCGCTGCTGCCATTGAAACGATGGAGCGTCACGGTTACGATCAGCTGCCTGTGGTGAAGGAGAA
TGGCACTGTGCAGGGTGTGGTGACCATCGGCAACTTGCTCTCGATGCTGTCTTCCGGACGTGTTAGCCGCACTGATGCCGTCGCGACTGTGACTTTCGGC
AACTTCAGCCGCGTTACCCACGGGAGCTCTCTGGCCGAGCTTGCCACTATCTTCGACAAGGACTACTTTGCCGTCGTGACCTCAGCTGACGGCAAGATTG
CTGGCCTCGCTACGCGTATTGACCTGCTCAACTACATCACCAGCGCACACAAGGACTAATTGCTGGCTTTCGAGGCTAATATCGTGGTAGGTACATCGCT
GTCTTTGCCTGCAGTGGTTACTACGTAGTAATAGCCAATACAGTATTTCCAACATGGTTTTCTTAATTTGTCGGTGTCTGTTTACTGCGGCTCGGAGCAT
CGCGAAGGTATCGTAGTATGACATGCTTACCATGACCGTCATTTCTTATCTCCCACAGACTGTGGGTCACTATACAAGAAATTTACTGGACTGGTCAACC
CTTCATCTAAGATATGAACTCAGGGCAAATCACTCTCACCCCGTTCTTACTCCACCAAGTGCCGAACGAAAACTCATTTCGCCAGCCACTCAAGCGATAA
TACGTGGTCCGTCACCGAAAAAACAGCTTTGGTGAATGTTGCTTGCTTGAGTATGCTGGAACAACGCTCTCACGATAGCTTGGTGAAGACCAAAGCGAGT
TGGTGACGCGATGGAATATGTATTGAATTGTAGCTATATACCTGGTAAGACCGTCACTACATGTAGCAAGTTTGGACAAAATGGCCACATCATTTCAGTG
GATTGATACCACGATTCACACCATTGGATTTTGCTATTCAAAATGTACCTCGAACCAACACCCACGCAAAATTATCTGAGACTTATATTACGTATGAAGA
TTGGCTAGATTTATTCAGTACGATTGGAGTGTGGGCAAGGTAGAGCACGCCGTCACCGCAACTGTACTAGGGCGTCTGTCTGACAAAGCTCAGACTCTGT
AAGACATGCCAACATGTCCCTCCAACAGTTCCACGTCATGAAGGTTGTTGCGTGTTATGCTAGCGTCCCAGGGTCTCTCGTGGTTAGCAACGAGGTTCAT
TCTTCGTTTGGCGCCCGGAAGAGCAGATCGCAGCACTCTCGATACCAAGCCGGCTCAATGAAGGCCATCCTCATGAAAGTGGCAGTCTTATTGACAGTTT
CACTTCAGAGCGGCACGAACGGATTGAGCATTGCAAACCCAGACGATGGACATCGAGCATCCGTTATTCAAGCCAAAGCCCAGCTAATCCAGAACGTCAA
CCGAACCTACTCCGTGAGAGATCAAACCTTCGTTCTGAACCCTGGTCCTGAGGTGTCTACAGCGTCGATGCTGTACTTTGAGCACCTGGTGGGGCAGGCC
ACCGCGCTTACAGCAACAACCAACTTCAACGCCTCCAAGATCGAAGCTTTCATGAACGAGCGACTCCCGCTGACACGAGAGGAAGACTTTCGACAAGCGT
ATGAAGATTTGGCAGCCTCTGGTATGATCGCTGCGCCATTAGCACTCGACCCAAGCGACGAAAACTTTGGCGCCATGCGACTCAGCATCCTCGGCAACAA
CCTGAAACTGGTTCACAGCGGTGAGTATGCCGAATATCTGTGGGAGGTTCCGTCGTTTCTGCTTCAAGACGTCTGTGGGGAGCCAGCGTTGGCGAGTGCC
TTGAAGAACCATAAGCTGTACGTAGCAGACTTCTCCGACTACGGTGATTTGGTTGACAAAGCTGTCAAAGACACCAAGTACATCCCTAACGTGATTGGGT
TCTTCTGCAACAACGTCGAGAAGCATCAGCTACTCCCGCTGGCAATCACGCTGATCGATTCAGAGCTGACGTACACAAAGATGGACTCTCCAGGTGAATG
GCAACTTGCAAAGATGGCGTTGCATGCCACAGAAGTGAACTTCCAGCAGATGCGGCATTTCGCGGAGACTCACTTGATCTCGGTTCCGGTCCAGGTCGAG
ATGATCCGCAGTCTATCCACTGAGCACCCCGTGTACGCATTGCTGGACTACCACTTTTTCGCGGACTTTGGCATGGAATACTTCGCTAGGCGAGAACTGC
TGAGTATTGGCACGCCATACGACCAAGTCACGGGGTACGGAGCTACCGGATCTCTTCGAGCTGTGATGCGGGAATTTGAAACAACTTCCATAGCGCTCGA
CCTACCGACAGACTTAGCTGCTCGCGAAATCGAGTTCCTGCCCGACCATCGGTTGAACCGCTACGGCACAAAGTACTACGACATCATCAAGGTGTTTGTA
CGAAAATATGTGGAGGCGTTCTACCCAAGCGACGAAGCTGTTCACGAAGATGCCGAGCTGCAAACGTGGGCGGCACGAAGTTCTTGTCTCGAACGTATTC
ACGGATTTCCGTCTTCGTTCTCAAGTCACGACGAGCTTGTGCGAGTATTGACGCATTTCATTTTCCAGAACGCTATCAAGCACCATTTCATGAATGGCCA
AGCGTCGTGGCACAGCATCGCGCCTCCATTCCACGCCCCAGCGCTCTACAGCAAACCCCTGCCGACCAAGAAAGGCGTGGAGGTAAATCCTCTCGACTAC
GCGGTACCGAGTGACCTGGCGCCCAAAATGGCGTATCTCTACTCGTGGTTCACGCGGCAAGTGCCTGTCAACGCCTCCGCGCTCCATTTCTACGAGGGTG
AGCCTTTCACAAGCGAAGCTGTACTAGCGGAGCCGATCCAGGAATTCCAGCAAAGCATGCGCGACATGGAGCACTTTGTCAACTTTGCCGAAGAGCAGGA
AGCACACCCAACGGACATCTTCAAGCCGTCGTCGTTGCCTTTCTACTCGTTTATTTGAGATCTAGACAACTTTCATCCTACCATAGCAACTGAATGGATT
TCTATCAACTTCAACTTGCCGCATACAAAAAGATAATCAACCAGGACATCAATTGTTTGTTTGTCGTCATGTGGAGCGTGGCGATATACATGCCGTGTCA
TTCCGATGGTGGATAACGTTGCAGTATAGACTTACGCCGACCTTGCACGCACATTCCAATCGTGGTTTCCTTTAGGTGAACCGCTGGCTCCATTCGACAG
CAGCATGGGTTCGCGAGCGTAAACCCCACGGAGGTGGACTCTGCGTTGACGATCTGTGGACAGTTGGCGACGCTAATCGAGTCGCATCTTGTGCTGTGGC
CATGCGCAGGTGTCGTTGCGGTCGCACCTTGCTTCATGTGGGGTTTCGATGGGGGGAGGGGGGTCCTGGTTCCTGAGGCTAGCAATCACCTCTACAAGGC
GTCTCACGAAGGAAAGGAAAGTAAAGATATGACGGGGTCTTCCCGCATTGCTAGCGCTGGAGACCATGCCAGCGGGTTCAGGAGCGCCGCACGCCTTGCA
AGCCGCGATCTCAGAGCAGCGATGTTGTGTGCGGTGGGCTTCGAATCAATGCCCGCTCCATTCAATGGAGACCAAGTGCTTGGTACGCACCATCTCGATG
GGAAGCTAGTCGGCTTCCGACACGAAAGACTCGCCACCGAACCGGGCAAGGCAACGTGAGGACAACTCCACTGGACACAATTGTCGGCTTTCTCTCCGTG
AAAGGCAGCACCGCGCTGGAAGTCTGAAGTAGCTAAGACGAGGACGGTGAGCACACAACGTAAAAAGCCCAGCAGAAGACAAATCGAGACGCCCACTTCA
ACATGCCGACGCAGCGCTTCTCGCACTTGTTGAAGCCATTGCTGTGCTCGGAGCAAGACGACGCCAATCTCCGCGAGTTAGCGGAGACTTTGGTGCTGCA
CAACATTGACCAGTTCAACGCTCTGGAGGTTGGCGCGACCGGAGCACCAGCGAACAAGAACCGCTGGAAAGAGATCCGGAAGAAAGAAGGCACGAAGATT
TTCAAGGAGCGCGCCACTATGGGAGAACCACTGGAGATGCCTTCGATCATGCTGCTGGGCACGGTGGTGGGCAAGCTGGAAGACTTCATGTACGCCGTCG
TGGCTCCCTCCACAGACGCAATGCGAGTCAAGTCTGCGCTTATCCAGGACGGGATCGTGGACTGCAAAGTGCTGCGCGAGGTGGTGGCGCCCAGCATGGA
CGACCCGTTCCACCACGTCGGCGTCAAGTGGCGATTGTTCGACAAGCCGGACCTTCGGGATCACGTGTGTCTCGACTCGACTGGCATTGCTACTGTGGCT
TCGGGCGAACGTATTGGTTACCACCTGACCCATTCGGTTGGATTCGAGCAGGTCCCGAGCTTTGCGAGCTACGACGTCGCGCGAGGCAACATGTCGGTCT
GCTCGCTGTATGTCCAAACCAGTCCGTCCGCCGTCAGGGTCTACGCACGCGGGTTCTTTGATTTCAAGCGAGGAAGGCGAGGCAAGAACGAGCTGATCAA
CAACGCCGCTCTCACCGCCACCGCGATGCAGTGGTTGTCCTTCCCTCGTAAAGTCGAGTGCGCGCAGCTGAAGAAGCTGCTCTGGACGATGCACAAGAAC
AACAACCGCGAGTCCATCCTGTCATTGACCAGCGAAGAGGGCAAGTCCAAGACGCCCAAAATGGCGCCGACGCCAGGACTGTGCAAGGTCTGCTCCAAGA
GCTTCGGCTTTCTCGGCACAAGCCGCAAATCCTGCAAGGCCTGCAACTACCAAATCTGCGCGCGATGCTCTGTGATCAAGACCGTGGTCATGCTTGCACC
GAACAAGGTGTCCATGATCGAGAAGAAGCGCGCCTTTTGTGTGCAATGCATCAACGACGTCGTGCGTACCGACGCCTCACGGATCGCGCGAGAGGAGATC
CTCAACGCCGGCAAACAGGTAGCCGCCTACTTTTGAGACTTGGTCGCTGGAGCGAACCATGACAAAATGCCAGGAGCCCAGCCGTGTAGGAAACGTGTTA
CTAGAAAAGAGCTTACTATTTTTCTTTGGAGGTGGCTTCGCACGCGATTCCCGCACAAGAACAACAACCGACGAACATATCGTAAGCTTATCCCGTTTTC
GGTGTGCCACCCCAAATAGCGCTTTCGAAATCGAAAATTGGACGGGAATTCTGGACGGAAGCTCAACTCGGCGGAGATTGTCTCGGATTTACGGCAGCTT
CGTCCATCCCAGCCGAAACTCTCGAAGTCTCGACATGCCTGGTATGCACGGCGGGAACCATGCACGTTACGGCAACGTAATGATTGACAAACATGCCAAG
CAAGCATGCATCTTTATTCGACCTCTTTCCCAGAACGTTGCAGAGAAAGTTAGAAGCAGGAAGTATTTATTTTAATACAGAGCACTGCTACGTCACAGCA
TAGTACAACTGGTAATAGTAGCACAGTGCGAGAGGAAGCTACCATGTCACCAGCGCCATCCTTCACTAACCTTCCTATCAATGATTTATAATTGTGTCTT
GCTAGACTCGTGTGCGCTTGATTGACGTCAGGACGTTTGTTGAGAGTCACTTCCGAGGTTTGCCGTAGTAGTACTATCTTCAATATACTATCTCAAATAG
TACTATCTGATTTCGAACATCAATGCGCGGCTCTACACCGAGACGGCCGATTGGCCTTGAAGTGCGTGGCGGCGTGTGCTCGAGGGTCTCCACTATCCAT
TTCGCGATCGGGACGCCAGGACCAAGCTGCAAAAGCGCCTTTACATCGACTTCACCGCCGCTCCAATGCGCCCGCAAGACTTGATCCACTACGTACCACA
GCTGCATCTGGCCGAGTCGGACGTGGCGTCGCTGCGTGAATTGGCCGACACGTTGGTGACGCACAACATCGAGAGCTACAACGCGCTGCTGGTGTCCCCG
GACGGCCACGTAGACGCCCGACAATGGAAGGAACTCCGTCGTAAAGAGGGGATTCGGGTGTACAAGGAGCGACCCACTGACACTTCGTCCACGCTGCCGT
GCATCCCGTCGCTGCTGCTGCTCGGGACGGTGGTCGGCAGACTCGATGACGTCATGTTCGTAGCGGGGGCGGCCACCGACGAGCAGATGAAGCTCACGGC
CAAGTGTCTGCAGGACGGCGTGCTCGACAGCAAAGTGGTGCAGTCCATTGTGGCTCCGACAGAGGAGCAGCCGTTCCGACACGTCGGAGTCAAGTGGAGA
CTGCACAACGCCAGGGACTTTGTCTGCGTGGACGCCACGGGCATCGCTATCAGCTCCAAGGGGGAACGGGTGGGCTACAGTATCCGCCACTCGGTCGCGT
TCTCGCAGCTCCCGAGCTTCGACAAGTTCGGGGTCGAGCGCGCCAACATGTCCGTGTGTTGTCTGTTCCGTCAGAAGACGCCCGAGACGGTCGAGTGCTA
CGCGCGCGGCTTCTTCGACTTTGGCAGTGACAGCAGCGAGCTGCTCA