Description :
From Genome Similarity Track
Location :
Scaffold_163:33751- 37527
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_163-fgenesh-gene-0.14P-type ATPase (P-ATPase) Superfamily
Pytir_DAOMBR486maker-pir_contig_163-fgenesh-gene-0.640 kDa peptidyl-prolyl cis-trans isomerase

Sequence
3776 bases(100 bases per row)
AGCCCCAAACAGAAAAGCTTCTATCGACTTTTTCAAGCGCTGATCCCAGGGCTGAGTCTGCGCGTGCAGCTGCATCCGGCGACGGCGCTTTGACTCTAGC
GACTTTGCAGTAGGTGACATGGCTGAGATCTTCTCTTGACGCATTGCCACCTCTTGCAACCCTTTCGCCACTGCGACATATTCATCTGAGGACACCTGCA
TCACCTCCATATCGCTCGTGAGCAGAGAGCACGCGTATCCGATGTTAATCGCCGTCTCGATTTTGTCGCCCGTCAGTGTCCACACTTTCATGTTTGTCTG
TTGAAGCAGCTGTAGTGTCTTGGGCACGCCATCCTGCAGTTTGTCTTGCACAGCAGTCACTCCGAGCAGCGTGAGATCTGCTTCAATCTCGTTCATGAGC
GGATCAATTGCGTTCGGGAGCCCTTGACGCCTCTTCACGAGCTCGTCCATCGACGACATGGCAGATACGAACCGCTGGTTCCACATTTTGTACTCTGCGC
GGTCGATTTTCTTGTATGCCAGACATAGCGTGCGCATGCCGCACTTGGCGTAGTGGGATAACTGAGCGTACACTTCGTCAACTTTCGTTGGATCGTCCGT
TTGGTCTGCTACGAGGCGCTCCAAAATTACATTGTCAGCACCTTTGCACAAGAGCAGAATCTCACCTCCTGGGTCTTCAACAATCACCGTCATTCGCTTC
CGGTCGCTGTCGAATTCCAAGAGATTGAGCAGTTTGTAGACGCTAGGCTCGTCGAGTCCAGGCTCCAGAATCGTCAGTGCATTTGGTGTGCGGTGCACAA
AGCGCACATTGCAGTGAGCAGCTGCAGACACTAGCGCTTGCTCATCCGGAGAAGAAGCCGAGTACTGTGGCGATGTGCTTGCACACATTTCTGCAAACGG
CTTTGCAGGAATCAGGGTGTGACACAGCGCCAAGTGCCGCAGAAAGAGTCGAATCTGATCCGCGTGCTCGCCTCCAGCTCTGAGATCAGCAAACAGCTCT
GTCGGATCAAACTTGACGAATTGCGAACTCGATGCCTGCGTCGCAGTACCAGACGAAGATTCTAGAGTATCACTCTCCCGCACTTCACCGCCGTAGTGTT
TCCCAGCAATCATGCAGAATCGAAATAGCATCAGGTTCATCGTCAGTGTTCCGGTCTTGTCTGTGAAGATGTGGTGGACGCGTCCGAGATCTTCATTGAG
AGCCGACGAGCGCACAAGCGCAGGAGTATCCGACACTTCGTCATACATATTCAGATCTTGCTCGATGAAGTATGCCTGCCAGTACTTGACAAACTCCAGC
GAGACGTTCAGCGAGATCGGCACAAAGTTCTGCATGATGATGAAGTACCGCACGTGCAGCTTGATGAGCTCTTGAAACGGGAAGTGGCCACTTCCATGAT
GGAACGCAAGTTGCTCGCGGGGCGGATCCAGTTCCAGTTCTCCAATCTTGGAAGATCCGTGCAAGTACCAATACGAGTTTCCCTGGCTGATCATCCAGTA
GGCACCGAGCAGCGCGCCAAGCGAACACACGAGCTGCTGGATAAAGACAACGCCGATGATCAGTGAATTCAGGCGCTGCTCCACTGAAGACGTCTTCACA
ACGGGATCAGTGTTGCTGCAAAACACCTTCGTCTCGTGACCCGTGAAGATTGCGATGCCAATGATCGCTCGAGTGTTGCGAACTACACAGCTGCGCAGCA
CCATTTGCTTTGCTGTGATTGGGGTGCGAACACTCAGCAAGCCGTCTGGACTCTTCTGCAACTGCTGGAGCAAGCTGTGACCTGTCCTTGCCGAGTCTGC
CACTACTGCTGCTGTTGGCCGATCCCCGCCCTCCACTGCACCTTGAAGACCTAGAGCAGCAGCCTGATTTTTGTCCAAAGTCACGGAGAAACTCCCATCA
AACGTCGCAATCCGGTTGTTTGGAGGCTCGCACTCGATCACGCCACGAAGCGCGTTGAGGTCGCAGGGAAGAGATGACAGTGTCGCAACCACTGGGATCG
CTGTTCGGATCTTCAGATTTGTCTCTCCGTCGAGCGATTTGGTTTCAATGTACGCCAAGTTCCCGCCAGAGAGTGGTTGTGGCTGGGGTTCGTCAGTGCC
GGTCTTCTCAGAGAGATCGATCTGTTCATAATCCGCTTGACCCTTCTGTAACGCGTCTTCACCGTTTTCCTTCTTGATCTTGCGGACGACTTCAGCATCC
AAACTGGGGTCATCGAGTTCTTCAGCACGGAGCATGAACAAATCTGCGGGGACTGTCTCATCGTTGAGTACTTTCACGATGTCTCCCACTTGCACGTCGC
CCCACTGCTTCAGCTCCCATTCGCCCATCGCACTCATGCACAGAACAGACTTGCTGTTCATGAGCGCGTCGGCGCGGTGACGCTCGCGGTCTTCCAGCGC
TTCTTTGATCGCGCTGCAGATAAACACGAAGACCAGTGGCAACAGGATCGTCGGCACGCCGTTCGTGTTGCTCACTTCCTTGATCGTCTGAAGCACTGCG
ATAAACAGGAAATACATATTCGACGGACGCTTGACTTGCGCGAGCAGCACGCGCGGAAAGAAGTTCAACGCCGTGTACTTTGCGCTCACAACCACGTTGC
TCGCAAACTCAGCGTCATTTTCCTCGTTGTCAGCTGCATCACCCGCTGGAAACGCACGATACTCACGACCACGGCGGTGAGTAGATCTTGTCGCGTGGCG
TCCAAAGATACGCGTTCTCCACTGCTCGAGCGTTGTGTCCACTGGCTGCTCTTTGGCGGCGTCCAGCGCGCGCTTCATGCGCTTTGGGCGGTCGACGGAG
ATCACGCGCAGCGGCGACGACTGCTTCAGTGGCTGCTGCTTCGAGCGTGGAGGGTCTGATCGGCGGCGATGCATCGAGTTTGCACCGGTACTACCTGCCG
GTAACGAGCTCCGTGGCCGCGCCAACATGGTGCCTCCACGTCGACCCTTCTTCTTCTTCTCGTCTTGCTGTGTGTTGCTTGGGCGTTTTGTCTGTGTGAA
ATCTTGCGACACGAAAAGACTCACGAGTCTCTGTATTTGCATTCGATACCACCGTTTTATGCCATTTTAGAGCTCAATCGGCGGTTCAATAGCTGAACCG
GTCCCGCGGTTCACTCCAGTGCTTTTTGATTTGGATGAGCGAGCGAGTGAGCGAGCGAGTGAGTGAGAGAGAAATGGCTGACGCGCGATCATTTCGACAT
CAGAAGTAGCGCGACGCAATTGCCGAGCGCCACTCTCTAGGAGCAGCAGCATCACCATCACCACACTTAGAACGCGCAGAAGTCTACCCACCAACGTGCA
AGCATGAGCGACGTGCAATCGCTCAACAGCTCGCCATCGTCGTCCAACTCGAACTCGTCGTTTCTCGGCAACTCGATGATGTGGGAAAGCGTGTCGCTCT
CACCGTACGAAGTGATCTCGATCCAGCTCGAGAGCGAGTTGCAGCTCGCAAAGGAGTCGTTTGTCCAGCCAAAGCAGAACAAGAACGGCGTAGATCTCAG
CAAGAGCACAGGCAAAGCCGCGGGACGTGTGCGCGTGGAAGTCGTGACTGCGCAGGGACTCGCTGACGTGATTGCGCAAAACCCAGTGCTAAGCAACGCG
TCTTCGCAAGACCCAGCGCTGTATGTGTCAACGATGGTGTCGCCACTTTCTGCGTTTGAAAAGGCGACGAAGAAGCACTTGCGCACTGCTGCCGTGCCTT
TCGATGCAAGCAAAGGATGTGCGTACTGGAACGAAGCGTTGGTGTACGAAGGCGTCAAGGCGAAGAGCTTCTCGAT