Description :
From Genome Similarity Track
Location :
Scaffold_43:33751- 36850
Transcript NameFunction/comments
Physo_136074hypothetical protein
Physo_136075hypothetical protein

Sequence
3099 bases(100 bases per row)
TAGTATGAAGTGATTGAGATGCATTTATTTCTTCCAGGTGATACGCCTCTGGACGGTAACTAAAATGATGATTCGATAAGCTCGTACCCATGTACTGCGT
TCTGCACTTCAGCACTCTACTCCGCCCTAGTACCGCCATCGCAGCTCGAAGTAGCCCGTACAGTTCGATCCCAATAATCGCAGCTTGGGAAAAGTGATAA
CACCTAGTTAAGGCACTGACCGACCCAGTCAGGTTGCTCGAATTTCGAAAGCTTCCGGTCGCGTGCCACAGAGACTTGTCGTACCATTTGCTCGTCACGA
AGGCTTTCGCGTAAAAGCTGAAGCCACTTTTGGCATTCCAGCGCGTCTTCACAATTTCTTTAGTGTTACCAAGACGCCCAACCCACAGGGCTAACACTTT
TAGCCATTGCTCTTCTTCCTGGCAAGCAGCGACAGCAGCCGTGGTCGCTGCTGATGGAGCGTTGCTATGCTGGGAGTCAGCTTCACGAGACTTTTTCGCG
AGAATTTGACCGTATGCATCAATGGTCTTGATGTCGTATTTCACGCACCATTCGGGGACAAACTGAACCTGTTCGATCGCTCTGACCACTCTGTCTTGGT
AGTGATTCGAGCTCGCTTCATTCTCCCCCCCCCTTGCTGTTCTGGTAGTGCCGGAAAGCCCCATTGATCCCCTGCAACCAGAATTCGACTGGGAGAGCCT
TGTAAACAGCCAGCCCCATCGCGCCGAGTGACTGTAACACGATGAACGTGTACGCTCCCTTTTCCGGGACGTCTTCGGAGCTCCAACCGTAGATCAAGTA
TAGCTCGTCGGGTGCAAATACATCCGCCGGTGGGTGATACACCGTACTCCACATATTCTTGTTCGGCACAAGTTTCTCGGCCAAGGTACAGAAGCGCTGA
AATCACGCTGCTTCCACGTCAGCGTCTCTAACTGGAGGCAATTCGCGGATGACACGTGCGTTTTCGTGAGGCTGCTCTTCGGCTGAGTGCTCAACTGGAG
GGGCTTCAGAACCACTGCCGCTGTCGAGGTCATCGGTTGCCTGAATTTCGACTTCAACGTCACTCTCTGGCTGAACACTTGCAGGCATGGTTGAACAGAC
GACTGATGTCTGGTTTTCGCTTTGTCAGTTTTGGTTGGGCTCGGGTGTGCTGCTCGGGGAGAAATCTTGACTGTGAGCACGGAGCCGGCTTAGTGATGAG
CACCCAGGAGTTGTGAATGGAGCGAACGTCCTTCATCTAGGCAATGCGAGGTCACCAACGCCCTGCAACTGCTATAGCGGTCGGACTGTTGGAGACGCCC
ATACCACCGCGGTCGTTAAGGCGACAACAGCCTCACCACATTCGCAAGGTCGGCTGAAGAGCACGGCACCTTCCCAGCCCAATCACAGATTTTGAAAAGT
CGCAAACTGGGATCGAGCAAGAAGTGTGTACATATCGCGAGTCCGCAGCAAAGAGAAATGTCGTCGTGTTCTTCAGTCCGATGCGTCTGCAGTCATGTCG
AAGAGAGCATCAGATGTCTGGCAACAAGCGGGTCGGGCAACATCTACGACTAGGATCTTCATGTTGCATGAGTTACCTGTACGCCTTCAATCCAGCTAGG
CACTGTATCGTCATTCTACTCAGTATTGCACAAATGGTCGTTCAAAGAAATAAGGTTAGATGTGGAGCTCCTGGCCCCGGAACTGCGGCAGGTCGTTCGA
GAGTCTGCGCAGCTCCTGCAGCAGCGGCGTCTGCTCGTCCGCCTTCGTGATGCCCCAGGCCGGTGGCGCGGGCTGGTGCTGCCGCTTGACGTTCATCATG
TAGATCACGAGCGCACCCGGAATGAGCTCCGGGATCGCGTAGAACAGCCACGGGTTGGACACGTGCGGGTCGAAGACGTCGATGGCCGGCATGGAGAACA
GCAGCAGCAGACTGCGGTAGAAGAAAAGCAGCGACGACACGGCACCGATGAGCGAGAGCCTTGCGGCGATGGTCGCGGCCAGGGCCGAGAACTCGATCTT
AAGCAGCACGGCGCGCAGCTGCAGCGCGCAGCGGGCCAGCATGACGGCCAGCAGGAAAAAGCAAAGAGCCACGAAGCCATACTCCATCTCAAATAGCACC
ATCTTCTCCCCCGGGAAGAGCGTCTTGAGCACCAGCAGCGCGCACTCGACGAGGTAGATCCAGACGTTGGCCACCAGGAACAACTTCCGGGACCGGCCCG
ACCGCTGCGCGCCGGCTCCGCGCGTGTACTCGGCGATGACGGACTGGTTGGCGGCCACCCTGGCCAGCGGCTTCTCGGCGCGCCGCGCCTGCGCGCGCAC
GTCCTCCCAGAAGCGCAGCAGCAGCGTGAAGGCCGAGAAGTAGAGCAGCGTGGCCAGCTTGCCGAAGGACGTGACGCCCAGCACGTAGATGTCGATGTCC
GTGGGCAGCAGCGGCGTGACGAACACCATGTGCTCGTAGCGGAAGTCGGGCGCCGAGCCCTCCACCCACTGGAACATGTGCATGTTGCTCAGCACGAGCC
ACGCGATGCGCGAGAAGTAGGCGAACGTCAGGAAGGTCGGGAACCAGCGCATGCGCTTGACCGGCAGCAGGTGCGTCGCGTGCCCGTGCTCGCCCAGGCG
CCCGCGCTGGATGCTCACCGACAGCGTGTAGGCCAGCACGGCCGCGTAGCAGTAGGCCGCGCCCGCCGCCGCCGACTGCGTGTAGAAGCAGTGGCGCGCG
CCGAACAGGCAGATCTTGTCCAGCAGCTCCATCTTACGCCCCGCCGGCGGTCGCTCTGTCGCTCGATAGCGGAGACGTTCGATTTCTCTGCCAGATGCGC
ACTTAGCAAAGTCGGTAACGTTAGGTACGATTGGGCGGACCCTACGTCCACAACGACGATGGGAGACGATTAGCATGTAAAGTGATGAATAAGGTCTACA
TGGAATGTCCTGCTTACTGTACTAGTACTGTACACTGATGATACTTTACTGCTCTTCTATCTCTCTACACGTCGTAGCACACGCTCCTCCGGCGCGAGGC
CGAACGTGGCGACTCTGGCTCCGCGTCGGGCTCAACCGGGGCCTCTTCGCCATCACCGCCGCCGATGGGCACGCCATTTTCCAACGTCTGGTAGGAGCC