Description :
From Genome Similarity Track
Location :
Scaffold_557:3375- 4691
Sequence
1316 bases(100 bases per row)
CACGGTGCTTGGGCTCATAACCTGTTAATGATGTAGAGGAGTTGGGACGAAGCTTGGGGCTGAACGGAGTGACTTCTGCACTTGGTGCGGGGACCGGAGT
AAAGACACTTGAGCGGAAGAAGGAAGATTCGAAAGTGATTGATTGATCGGGGCTTACACAGTCCTCACTACCTAGGTCATCCAATCATTCTACTCATCCA
ATCATTTTGTACTCGTCCAATCATTCTACTCGTCCAATCATGGGTGGTATAAAGAACTTACCATAATCACAGCGGGATCGTATTGGACCGGTTCAGGTTG
ACCGGTTAATGGGTACAGCTGGTACACAGTACCAAGACCAGCAACCCTCAATAATTGGCTCTGAAAGTCAAAGGTCGATTCATCGAAGTTGACATCGCGA
CTGATAACCACCTGCCCCCGCTTCGATGTCATAAAGTCGATACGCCATGGATACTTCTTCGTAGCCCAGGAACAATCCGGCGCGAGCCTTCGGATCCCAC
TTGAGCCGTTTCTCCTTCGGAGCTAAGATGAAAGCTCGATAGCCGAAGACGCGCATGTGTTTCACACTCGGCGCGGACTTGTACACAATCTCGAACGGAG
TCTTGCACTCGATCTTTGGTGACGGCAGGCGGTTCTTCACGTAGATGGCCGTCATCGCCGCTTCACCCCAGAAACACTTGTCCATCTTGGCATGGTGCAG
CATGCTGCGGCCGATCGTGACGATGGTGCGGATGGCCCGCTCTGCCGTGCCGTTAGTCTGGTGCGCATACGGAACCGTGGTTTGTTGCTCGATGCCTTCG
TCTTCGTAGAAATCTTTGAGCGAGTTGGTCGCAAATTCACGAGCTCCGTCGTGTCGCACGAACTTGACCTTCTTGCCAAACTGCTTCTGCACCTTCGTGA
TGTACGTCTTGATGCAGTCTTCGCTTTCTGATTTGGCACGCAGACAGAAACCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGTAGCAAATACTTGCT
GCCACCAAGCGAGGCTTTCTCCATGGGTCCGCAAATGTCGAAGTGAAGCAACTCGAAGGTGTCGTAACGACGCTTGTCACGGTTGCTAGGGAATGGTTTT
TGGACCATCTTGCCTTGCTGGCAGCCGCGACACAGACTTGGTCCGCTAGGCTTGAAAGGTGCTTTCGCGTCCTTGATCATCTTGTTGTCGACCATCTTGC
GAAGCACCTCGACTGGAGCGTGACCCATACGCGCATGCAGGTCGACCGTCCTTCCAGTTGTCGCCGCATTTGCTGATCGAAGAGGCGTGCGAAGCCAGTA
GAGTCCATCTACGAGA