Description :
From Genome Similarity Track
Location :
Scaffold_56:33735- 35491
Transcript NameFunction/comments
Physo_137634reverse transcriptase

Sequence
1756 bases(100 bases per row)
GTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATAC
TTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCACAGTTCCTTGACGTTCGACGGTGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGC
GGACACCGTTTTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCAAGCAGCTTTCGGAGGTGCACCTTGTGCTTCTCAACATCG
CTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGA
AGGTCGCAGGGGTGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACG
CATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGAGGTATCGGTGTC
TGCACCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTATGGCTTCTTGATACAGAACGTCGGAGCACTGTGCGGGG
ATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACA
GTACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGCACGTCCGCGTACTCCCGT
AAGATCTCGTAGTAGGGACACGTTGAAAACGAGTCCCAGCTCTGCTCGTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGG
TGCTGTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCAAATTTGCTCGATGCGTCCATCGTGCAAGTC
ACGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN