Description :
From Genome Similarity Track
Location :
Scaffold_297:3372- 12893
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_297-snap-gene-0.9Ankyrin repeat-rich vertebrate
Pytir_DAOMBR486maker-pir_contig_297-fgenesh-gene-0.3Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_297-snap-gene-0.8Xanthine dehydrogenase

Sequence
9521 bases(100 bases per row)
GCACGTGTAGCTTGTGCGTGACGCCGAGCACGTCCGACATGTCCTCGGGGCGAAGCTCCAGCAGGAACTCTCCATCCACGGCTCCTTCGTCGAACGCTTT
CTTGTATTGCGAGAGGGAGAGCGAGTCCAGCCACCTGCCCACGTCGTCGACGTTCCAGTTGCGCACCTCGGGTGGTAGCGGCTGCAATTGCGCTTTCTTG
GCGTCTTCTTCGTCCGTGAGCTTCTGCTCCAGCTCTTGCTTCTTCAGCTGAGACGCAGCCAGCATCAGATCAGCGCCACCGACTTTCAGGCGATTCATCG
CGGGGATATTCGCTGCAGCTGCAGCAGCTGCGGCTGCTGCCGCGGTCTCAGCGGTGCTGGTGATCGCAGCGGAAGTCGTGTCGGCGTTGATGTCGCGCAG
GTTCTTGAGCATATTCAGCGAACTGAAATACGAAAGCGACATCGACATGAACTGGAACTTCATGAGCTCTTCGGTCGACTCGAACATCGCCTGCGAGCGC
TTCTCGTGCTCTTTTGCTTTCATCGCAGTTGCCGCTGCGGCAGCAGCCGAGGTCGCCGTGGCTGTCTCCAGCTCAATTCCTTTCTCGCGAAGGCTCTCCA
GCTCGAGCTTTTGTTCTTCGAGCAGCTCCATCAAGTTGCGCTGTAGGCGCGCAAACTCTCGGTCTTTGCGCATGCGGGTCGCCTCCATGTCGGCTAGTTT
CTCCTCCATCTCTGCGAGCGACTGGCGCTTCTGCTGCACCTCGCTGAAGACGCTGGTAAACTCTGCCTCGAGATCTTTCTTCCTCTTCTCGCGCTCCGCT
CGCTTGATCTGGATAGCCATCTCAACGGCGTACGCGTCGGCTTGGCGCTTTTTCATAGTCTCTTTCGTTTCGAAAAGACTCTCGACGCCAGCTTCATACG
GAATAGCAGCACCGCTTGCGCTGTTTGACTGCGGGATGCCATTACCTAGAGGCGTGGGCTTCTTATTGTTGCTACTGCCATTATGGCTGCTTCGGAGAAG
CCCTTCGATGCCCCCGTTATGCAGTATCTCCGCTTCGTGCGTGAGCTCGCGGAGGTCCATCTCGAGTTGGTCGATTTCCTGCAACTCCCGCTCAAGCACT
GCAAGTTCTTTCTCGGATTCCTGCAGCTCCGAATGAATCGAGCTCACCTGCCGCTCCACAGCCTCCTGCGCGCGGTGCAGCGCATCGATCTCACTCTGCT
GGCGCTCGAAAGCCTGCTTCGAGCCTTCGATCATCTTGAGACCCAGCGCCAAGCGCTCCGGACCGGGCTCTGCATTGCGCCACTCTTTCTTCCGAGACGC
CTCGATGCGACCGAGGTGACCACGATACATGCGCTGGATCTCGATCGCAGCTAATACTGAAAAGCGTGACGTCAGGAATTTGTCTCGAGCGACATACATC
TTCCAGGTCGCTTGAATCTTCGAAGCATTGCGATCCATGTACCGCCGATACGCCTGCGCTTCACGGAGCTCTAGGCATCGCGTGCGACCCATGTGTCCGC
GGTACACGCGCTGCAGCAGCACCACCTTCTTTGATCGAAGCTTGCGAACAAACTCCACGCGGCAAGCGTGTCCTCGAAACAGCCTCTGGATGACAACCGC
GGCAAATGCTTGCTGCTCTTCCTCTTTCCGCTGCACACGGTACTTGGTGAACTTTCGTCGACCAAGAAAGCCGCGCACGATGCGCACGATCTCACCACCC
GCGAACCGAGTGATGCGTTCTTGCTGGACTTGCTTGCGGTGCTTGCCCACTTTCTGGATCGCGAAATACCGGCGCACGTACTTTTGGATGCACGTGGCCT
GCGCATTTTTGCGCTTGAACAACTCTGCTTTGAGCGTATTTTCGCGCTCTCGAACACCTTCGTTAAAAGTCTGTGTCATTGAGGTCTTGATCTCGTCGAA
CTCATCGATGCGTAATTTGCCAATGCGCTTCTTTGCCTTTTCCTCGGCTTCTAGCTGGTCAAAGACACTCGGGAGATCCGGCTTGAGTCGAATCTGCTTC
TTCGTCTCTTCACTCGATGGAGATACTAGAAACGACGACGCTGGAGGCGATACTGACGAAGATAGTGATTTAGGGAGATTGTCAATCGCTGCAAGTGAAG
TCGTCAGGTCCAAGCTCAACAAGTCCGCTTCCCGCTTCTTCATCGCAGCGACCCGGTCTGCTTGCTCTTCCTGCAGCTTTCGCTCCAGTGCTGCTAGACG
CATTTTGTCTTCTTCTTCCCACTCTCGACGCCTGCGCTCTTGCTCTTGCTGCAGCGCCTCCATTCGCTCCTCTGCTGCTGCGCGCTGCTTCGCTCTCAGT
TCGTTTGTTTCTCGCTCGATTCGCTGCTCATTCTCAACCATTTTCTGACGAAGCGCATCCATTTCTGTATCCAGCACTGCGCTCTTTGTAGCCTCATCAT
GAACATCATCTCGAGTCTGATATGTGCTCTGTTTTGGGAAAGTGCTTGGAGCTGGTGCTGTTGGGATTGAGGGCGGTGCCATCTTCGCAGAAGAAATAAA
CTCCACCTGAGATTTCTGAGTGCCGACCTCATAGCTGGATGGGACTGCTGACTTGAATGCTGCCACTTCTGGTCTCTGCACTCCAGTTTGAAGAGGATCG
TCCGTCGCTGTCTGCCTTGTCAGCCATTTTTTCTTTTCCAGCTCCGCTTTTTGTGCTTCGTGTGTCTTTATGGCTTCTTGGAACTCCTGCTCGGATCGTT
CCAGCTGTAACTCGTACGCAGATTTCTTCAAAGTCTGACGCTTCTCAATGGACGAATTCGCAATCGTGACTTCCTCGACCAATGGCGCATCCAACGACAC
CTGCATATATCTTGGAGCCACTTTGGATTTTGACGGATCTGGTGTACTTGCGGTGGGTGTTTCTTCAGCGAGCGCTGCTAAGCTAGAAGCTGAAGTCTTT
CTTGCTGCATCTGACGGCGTTTGTCTTTCTGGATACAAGTAACTGGGCTGCAGTGTCCGCGCGGGCTGTGATGATGGTGGTGATAAGGCTACAGCTCGAG
TCGGCTCGGTATCACGTAACTCTGTTTGATCAATGTTCTCCTTCGAGCCCACGAGCAGCTCCATCAAGTCTGTGATGTACGTCTTGCACTCCTGACGCAG
TTCGTGACCGGCGCGAAGCCACGAGACAAACGCACTCTTGGGGGTCGCGAGCACTTGGCGGAGCTGCTTGCTGGTTTTCCCTCGGATGTCGCCGTTCTGA
GGCTGTTGGTGGGACCACGCGTGCAAAATGTTCACTCTGCCCTGGAGAAATGGGTCGACATTCGTAGGCGCCACGAGCGCGTTTTCCACTGACTGAACGA
TCACGAGCGGCACGTCAATCTCTTGGAGCTGGCTCACCAGATCCATGTGATGCAGCGCACCCTGGCAGATCCGAATCCGGCCGTCAAGGGTTATCGCATT
CGTTACTGCCGTGTAGATGCTGAGTACTAGATTAGGATCGATCTTCGCCAAGTAGGCATCGGAGAAAAGGAACTTGTAGAAGAACGTCACGGGTAAATCG
GGTCGAGAGGGCGGGAAGCAGGAGAATACATTCACAGCGCTGTGCAAGATCGCGGCCATTTGCGCATCCACTTTGGCGAACCCATTGCAAAGCACCAGCG
ACTGCAAGTATCCACCATACGCCTTGCCGTACAGAATCGTGTAGCACGCCGCGATGTTGGCGCCGTTGCCAAAGCCCACAAAGTGAAAGGGTATCCCAGA
CAGCACAAACGCCTTTGTATGCTGCAAATAGTTGAACAGTTCATGCGCTCTGCGCGCCTGCCAAATGTTGTTGAAGACTACTTTCTCGGCGGTTGAGTCA
CCCAAGTACGACGAGCCGGCTTGTCCTGGGAAATTGAAGAACAGCGCGCGAGCACCGACATTGCGCGCGAGAACCGACCGGAAGAACACTTTCGTGCTGT
CAAGAGTGTCAAACAGATCGTGGAACACCACGAGATTACATTTCGTGGTCTCCCCCACTGCTTGCCCTGCAATCGAGTACGGGATCTTGGTCACACCGTC
CTGGCAAGTGAAAACAGACTCGCTGGCTCCTGCGACAAGAGCGTCCGTAAGTCCCGACGGTGCGGCAAGGCGAGCCATCTGCTGCTCTTGAATCGCTCGA
CGAGCTGCGTCTTTCTGTTGGGTCTGACGTCCTGTTTTCGATACTGTTGCGGATTTCACCCCAATATCACGCCCATCTGTATCCCTGCTGTGCTGAGACG
TAACGCCACTGCTGCCAGTCCAACTTTCAGCACCACCATCGCCACGAGTTGTCAAGTGATCTTCAGAGAGCCCCGCTGGTAAAAGCTCTAGCTTCAGGTA
GCACAGCACTCGATTGGTGTCCCTGTCCTTGAATGCGGCTCGGTTCCTCCACGCATAGGCTTGCAAAACTGTCAGGATCCTGAGCAACCGCACACACAAG
TACAGTTTAGATGGAGCATACACATCAGATCTGCGAGTGATAAGCACTTACCAATCGCAAAAGCGCGCTGCGCAGGAACTGATCGGGGCGATGTGAATGG
GCGAGAACAGTGGGTTCCTTGCATGGGACGCTGCTTTCATGACGACCTCCAGACTCAAGTGGTCCAGATCAAACTTCTGCAGCAACCCGAGTAATTTCTC
CTGTGACACTACTCGCTTTAACTCAGTCCAGTTGCCTTCTCTCCCAAGAAGCACGATGCCCAAACAGCTCAGTACCATCGCAATCGCCGGGTGCGGATTC
GTGAAGCTGTAGAGCTCCGCCGCGTCTTTCTTCGTGATACTGGGCAGTATTACTGCAGCTGCGTGTCTCCATATCTGCGACCAGATGCGGCGTGCTTGTT
TGTTGTAGCCGTCCTGCTCAGCATCTGCGTCTTCCTCTCGCTCATCTAGATTGACAAGGAGCTCTTTCAGTCTGTTTCCACCTACGTCCATCGTGTCCCT
GGTCGTATCATCGAGTAACGAAGCTCGATTGCCTTGGAACTTGGCTCTTTTCGCTGCCGCTGCTCGTTTCTTTGCAATTTGATCCTGCGCTTTCATGCGC
ACTTTCTCCACAAGCGTGTAGAACTCAAAGCAGTTCTTGCAAACCTGCACTTCCTGATAGTAGTAACCGGGGAACGTCTGTCCCAGAGGCTCGCCGTCGC
CGTAGTACTCTTCAGCGAGATAGTTGCCGTCCTCACCATTGTGATACCGGCGCACAAATAAGTCCACAAGCTGTTTCTCTGCGCGAGTCTGCGCGATGAG
TTTGAAGGGAATTGTGAACTGTGACAGAACCGTTTCCTCGTGCTGCTGTCTCTGCGGCGACGACGGTTTTTGAATTTCGTAGAAATCTGCGTCTGCGTTT
GCTGCTGCGCGATTGCCGACTCGAGGCTGGAACTTGAAATTGTCTTCGCTGGCGCGAGATTCGACGAACGCGTTGGCAGCGGCTGTCGCTGTGAACACGC
TGCTGCGGCGTCGTGCGTCATTGTCAGCAGCAGGAACCGCCGCAGTACTAGAAGAAGCTGAAGAAGAAGACTGTTGCCGCTGATTGCCAAGCACACTTTT
CTTGTTCTCCAGTCTCTTTGCCGCCAGCGTGCTGATCTGGAGGTGGCAGTAGTCGCCGCTGCATCCTTTTTTCTGACTCGAGACCAAATGCGCAGCAGAG
ATCGTGCGTCGCCGGCCACGGGACAACGACGACGTTGCAGGAAGATACTGGAGCGCGTCTTCCCAGTCACGCGAGTTGCGCAGTTGACTTCGCTGCTTTT
CTCGAAATGGATCAAAACTGCTGGTGTTAGCTAACGGGTCACTCAGGTTGGGCGTTGAAGACGACGTTGCCATCAGCATCGGTCGTCTCTGTTGCGGCGT
TGGGGACGACAGGATCGCATCGATCAGTTTCTCATCTGGTTTCCGCATCGCTTCTGCTTTCGCACGTGCCAAGATGCGCTCGTTGACTGCGTGCGGGCCG
TCGTAGGCTCGCTGCGATTCGCCAGGATGCATGTTTGCGCCAAGGCTGCCAACATGAGGTGATTGCCCAAGCAAAGCTGTTGCTGACGGTGCTACTGCTG
TTCCTGTTCCCACTGACGCGACTGGAATCGTCTCGAACGCGTCTGTCCGCCAGAGGAACAGCCGCCCAAAGTCGTCCAGCACAAAGAGCGACACGCAGTG
CACTACGCGCACTTTCTTGCTCTTCTCGATGTAGCTGTCATTGTAAAAATAATGGAAAGAAACACTGACCATATTTAGTATCAGGAAAGGAAAGTTACGA
TGTACAATAGCAGCACACCTACCTGACGTAGTGCTGCACAAGGTCGTTCACCTGCACGTTCATCTTGTTGTCCATACTGATGATCCGCTGGCTGCCCAGT
GTGAGGCGGAAGAGCTTGCACTGTGGTCGGCCAGACTTGTGGAGGCTAAATGACACAATGTATCCACACAGATATCATTGAGAGATACGTTAGTTCAGCT
CAGATATCCACACACAACACATCACTAAGACCGACAACGAATGAGTGTAAAAAGCGCAACCTACGTGAACTCGTGCTCGAGGTTGGCGTATTTCGACGGG
TCAAGATCCCCACGCGGCGTGACGAACGCGCTGATGCACGCGCTGCCATCGCTGCTCGCGAGCGAGTTGAGGTACGTGAGCAGTTCGTGCGCGTTGAAGA
ACTGCATCGTGCGGATCTGGTCGCCGAACCAGCACACCGCGACGACGTGGTGGTGGCTGCCATTACTATTGCTATTGCTATTGCCATTGCCGTTGGTATA
CGCGCGCGCGATCTTCACAAACTCTTTCTGGACAGCCTCGATGGCGAGTTTAGTACGCGGCTTCTTGCGGATAATGCCGCCCGAGTTGGAGTAGAACCAC
GACCAGATCTGCTGCTTCTCGACAAACACCGTGTCCACCACGCTCACCGCGCACTGTACACGCACATATATAACAAATACACACACATCAGCCACACTCA
TCTCATCATAAGCAAGAACGGCCGCTCTACACACAACCGCTTACCTCGCCCTTGTCCTTGTTGACGAGTGCGCTGCAGACCCACGCCCAACAGTGCCTCG
TGCGCGGCTCTGCGGGGTCCACAGTCGGCACGGACGTGCGGAAGAGCTGCTGCTGCTGCATGGTAGTCTGTCTATATGGAGTGTGTGCGTGCGCCACCTG
TGTCGCGCTGGTTCATAGAGGGGTGTGCGCCGTCATGCGCGCGCTACTACCGCTGCTGCTGCTCTCATTATTGCGGCAAACCAAAATGGCTCAAGTTTTG
AAACTGCAACGGGATCTTTAGAATTCGGTAACCGGTTTATCAAGAAAGGAAATCATGAGACGATAATACCCGTCACTATAAGCGACGTCTACTATACAGC
GTCGTCTATTGGCTCCTTTTCATCCTTCCACTGGTCGTGATGGTGCCGCCGGAAGAGCTCCAACTTTTCCATCGCCTGCGCGAAGAACGGTGCCACAGCT
GCCGGGTGAGAGCCATTCTCCGGCAGCTTCTGTAGCACGAGCGCATAGTGGCAGCCACGGCCAAAGGGTGTCCACACGCGGAAGCGAGTCGCGTGCACAC
GCACTGCGACGTCGTAGATGAGCGGCCACAGCCGATGTGTCGAGTCTGTAAATAGAAACACGCTGTTGTCAGCTGCGTCCTGGAAGAGCGAGCGCAGAAA
AACAAACGCGCTATGCTGCAGAAGCTGGAAGTTCTCCACGCACACGAACGAAAACACGAACAGCTGCGTCGCGGCGATGTCGCGCTGCACCTCGCCATTC
ACTGCGTCGTTGACGTCAAGCGTGATATCGCAGCTCTTGAAGCACCACGTCGATTCGTCGTCGTGCACCTCGCCGAGCGTCTGCTGCACTGCTGTGACTG
CAGACGCCCAGCCTGGCTCATTGTCGTACACATTTGTGTGGAATCGGACCTCGTCGGCGCGTAGAAATTTGCGCAGCAGCACAAGACCCGCTGTATCAAA
GCCCGGGCCACCGCCGTAGAGCGCGACTGTTCGCTTGTCTGTGCCGCCAGCTCGGAAGATCTCGGAACGCAGCTCACTCAGCTCTTCGGTCATCAGTAGG
TTTGGCAGATTGCCGCAGCGATTGATCTTCGCTTCGATGTACCCGGATCGCGCGTGTGCATTATCAAACGACGGTCGCACTCCTGTATTAGTCGACGCGC
AGAGCCCCTTCTTGAGCTCCTGCGTGTTTGAGATCGCGATGTGCGGCAGACGGCGCAGCAAGTGGGGTAGAAGCTGCTCGCACTCACGGTGGATGTACGT
GTGCCACACGTGTCGGAAGCGCCGGCTCTCGAGGTTCCACACGGACTTCTTGGGCTGCACGGCGCCGGAGAACTGGAGCCACGGACACGTGAAGAGCCAG
CGTCTGCACACGCAGCGTAGCTGCTGCTGCTCGCGAAGCGTCAGGAAGCGCGCGACCTCTGCGCCGCAACTTGTATCCATTGTGCTTTGTTGTGTTGTGT
TGTGATTTGCAATCTTGGAATCTTGGGATTAACCCTGTCCACCTGTGAAACGGTTACATGTCGGGACCGTCCACCTCGGTCCACTGAAATGCACTGACCG
GTCCAGCGAATCTGTCCATCCAAGAATCACTCCTGAAATTGACACCACTCCGCCTTCGACTACACTCTCGTTCAAGTTTATATGTTGCACATCAATCAAT
GCAAAAGACAATTTCATGTTAAATGATTGCACTCTAACGGGAGACAATCTTTCTGCCCTCTCACTTTCGTTCTCCCATCTGGTTCGTTGTTCTGGGGGTG
ACTGACGACACAAGCGAATCAGCTACGCACGCTCAAAGCTCAAGGCTCGAAGCTCTTGATCATGCAAGTGACGCCGTCGTCCTCCTCCTCGCCGGCGGAA
TGGGCGAACGTCGTGACGTTCACGCTCAACGGCAGCAAGGTGGAGCTGGTGAACCCCAACCCACAGCTCAAGCTCATCGACTTCCTGCGCGACAGCGCAC
ACCTNNNNNNNNNNNNNNNNNNNNGGCACGAAGCTCTCATGCGGCGAGGGCGGCTGTGGCGCGTGCACGGTCGTGCTCTGCAACCGACCGCTGGACCATG
TCGTCAGCAACTCTGCTGTTAATGCGGCGACGAATGACGTGGTGTACCGCGCAGTGAACGCGTGCCTCTTCCCGGTGTGCGCGCTGGACGGTATCGCGGT
GACCACGGTGGAAGGCATCGGGTCGACTTCGACAGGCCTCCACGCGGTGCAGAGTCGTTTGGCAAAGTCCAATGGTACGCAGTGCGGGTTCTGTACGCCC
GGCTGGGTCATGAACATGTACGAGTTGCTGCACCAGCACGACGGAGCGAGCAAAAAGAAGCTCACGAAGCAGATCGTGGAGGACCACTTTGACGGCAACC
TCTGCCGGTGCACAGGGTACCGTCCGATCTTCGAGGCTTTCCACTCGTTTGCGGTGGATAACGACACCGCAAAGGCTAGCTGCGACAGCAGCAATTGTAA
AGATCGATTAAAGCCCCTTGAACTAGGATACGATCACGACGACAGCGAGAAAGAGATTGGATTGCCGAGTGCCTGCAGCTCGAGGAGCTCAAACGACGAC
GACCACCGCCTGGATCTGCTG