Description :
From Genome Similarity Track
Location :
Scaffold_2005:3371- 5630
Transcript NameFunction/comments
Phyta_totarag13984hypothetical protein
Phyta_totarag13985reverse transcriptase

Sequence
2259 bases(100 bases per row)
acgtctcTGGGAATTTCTCCCCCGGGGAGTAGGTAACAAGGCCGCCATCTTCGGAGAGGAGAGAAGCCTTCCAGCAGGGCGTCCCGCTCCTACTGGGAGC
CGTCGTTTTCGACGTCGCAGACTCATCACATTGAGAGAGTGGGCGTTCAAGAGGCTTTGCCTCGGGTCTCACGCCACGGGTTTGTCGGACACTCACGACG
GAAGTGCTCCAGCTGATTACAGCCGAATCAGCTACCACTCGCACGCGGCTTTCGCGGCGGACGGGTCGACTCCGCCGAAGAGATCTCCATGGGAGTAGGC
CCTCCATTGGCCTCCGGACGACCGGCGTATCCTTGCGCTGAGCACACGCAGTGGTCTTCCAGCATTGTGATATGGACCGCCTCGTTAAACGTCTTCGCTT
TGCGACGAAAGAGTTCCGTTCGCACCGGGCCCGAGCGAACTCCGTCCATAGCAGGTTCTGGAGTTCCATAATATAGTCTTGAAGTGCTCTATGAACGACC
ATGAGCTGAAGTACCCCGGGGATGACGTCTCTCTGGCCCCATTGCCCAAGCTCGCGCTCGACCTCCCAGTTTGGCCAGCACGAAGTCTACCTGGGACCTT
GCCTCATAGCTCTGCCCCGTGCTGAGCTCTATCTCTATCTCGCGAATCCAGAAGACAAGGCTGTCTGATGCCTTGCCGTCGAATTTCGGTACCGACTCTT
AGCCGGCTTCGTCGCTCCCGATCGCGTAGCGACCCGAGCGGAGTCCCACACAGCGGCCTGAGCCGCGCTCGGCGCTTCGGGTCGCACCGCCGTACGAGCG
GCTTCGTGTGCCGCGGCGCTGACGTGCGCGATGAACGACGATTCGTACTAGTCGAAGCGCTCCACGCGCCCCTCTGCTGCTCCGCAGGAAGAGAGGGGAA
TCCAGCAAAAGCTGCTTCACCAAGGAGACTCACCATCTTACCCAGAGTCGCCCAGTGGGCTTCCGATAGATGTGGGAAGTCCTTGCAAGACAGCTGACGA
TTCGTTGAGTCCTTCATTCTCAAAGAAAACTTGATTGTTGTAGTAATTCGCGTCAATCCCGGGATTAACTACAAATGCTACCAGATGTGACGGGGCTCAC
ATGCACCTTATCTTGAGGAAGCGTTATCCTGCTAACCACTACAGATACCAGACGTCTCTGTTGTCTAAGTAGTAAAGGCTCTGCCACTAATGTCGTCTGA
GGTACcgagtaccgaacgacttgcgaacttccgGGTTagagctaaactgactgtattatTATCAATTTAGGTCCTCACTACTGTAGACTGCTTTAATACT
AAACCGTCTTCTAATGACGCTAAACTGGATGAGTGGTCCTCAGCTAACCAACTAATATAGGTTCGTTTTGATGCGTACTTAGTCGGGAAAGCGTACCTAA
ACGAGAACTGTGTGTGCTACACcttgtgtgtgtgtcttaCACCGGAAAGTCCTATTATTTTTgctccgccgtctcctgacacggcgaggccacacggCGG
CCCTGCTACGGTTGCAAACGTCCAGCACAAGAAAAGTTTGCGAGCTCACGTGCAGCAGGGCTacacgaagaagcgaatGTGTATCAATCCAAGCTTGATG
ACGCGCTCTCACGGATAGAATCCGCcggcgacgagaacacgaATCCGTCCACCCACTGGGGATGGACGAGGAACGCGCGGAGACGGGTTCTGCAAGAGGA
AAGAAAAGACAGCGCAAGTAGAAGTAGCTGCGTGAGGCTCGGTCCGGGACCGAGACGGTAAACCAGATGTCTGCCAGGCAGGCATCAGGTCCGACGTCAA
GCGTCGAGACATTAAATGTCTTGACGCAGACCGGTACTGGTTTACTGTACAGGAGTACTACTCTTGAGAGCCCTCCGTCGGAGTTGACGTCGCTTCCAGt
catgagctggaagcgcttcgcGCGCGACTTGCACGATGGacgcatcgagcagatctGCATCCTTTCAGACAAGGAAAGGTTGAAGTGTGAAGCGGAAGAG
TTGAAGCAACTCTTCGCTGGCAGTACCACTGAGAGTGAGGACACtctcagcgccaagacgaagaagcagcgcttcgAAGAGCAGAGCTGGGACTCACTCA
AGTCGAGTCCCTGTTATGACGTTCTGCGAGAGTACAGAGACGTACTCCCGGACGACATCCCTGAGGAGCTCCCGCAGAACAAGGGAATTCAGCACGAAGT
ACTTTATCACGCGGCAGTGTCCACTGCCGCGAGAGCACGTGAAGGcgatcgacgacttc