Description :
From Genome Similarity Track
Location :
contig_39:337091- 338125
Transcript NameFunction/comments
g6969.t1conserved hypothetical protein
g6970.t1hypothetical protein PHYSODRAFT_556200

Sequence
1034 bases(100 bases per row)
GCGCCAAGCAGAACAAGAAGTTGACGTTCGCAGACGACGACGAGAACTACGTGCCCGAAGACACTGGAGACAGCGGAGGCGACGCGCTCGACTCGTTCCA
GCTTGGTCTAGAAGGAGAGGAGGACGACGACGAGCCCACGGCCAACACGAGCAATAGGAAGCGCTCGAAAAAGGTCAAATTCTAGAACTCAAGCACGTTT
TTCATGAATCCATGTATGGCATTTACCACTGAGTCTCTACTCGGTCTTCTTCTGGCTCTTGAAGTCGTCTGGGTTGATGTTGTGCTGTCGCAGTAGCTCG
TTGAACTCTTCGTCGTACTTGTCCGTCTCGGGGTCGGCTACGCGCGGGCCGTGGTCCGGGTACTTGTCCTTGTAGCGCCGGAGCATGCTAGTGTGCAACT
CGTTCCAGCTCACGCTGTCGTCCTCTGTCTCCTTGTCCTTCTTGTCCTGCAGCTCCTTCTCCACCTTGCGCAGGCCGTCGAACAGCTCCTGGGTCGGGTT
CGCGCTCTTCTTCTTGGACTGTTTGGCGCCCAGAGGCACGAGGCGGTCCCCGTCCGTTACGAGCTCCTCCATCTGCTCCTCTTCCTCCTCGGACGAACTG
TCGCGGATCAGCTCCGTGGACAACGTCGGCCGCTGCGTCTCCAGCTCCTGCGCTTCCGCCTCGTTGTCGATCTGCCGGTTGAGCCAGCGCGCTCCCAGGA
ACAGGACCAGCAACGCCACATAGTACTTGAACACGGGCGCAAGGACGCTGGCAAAATCCCACAGCGAGCGCGGCGCTGACGGCAGCTCCAGCTTGTCTAC
AACTTCGTACTCGTCCATCGCAGCAGATACTGAACTTGTCCAACACGTCATCAAAAGTGTAGCCATGTAGAAATGATGTTCCATACACAAACCTCTCTAT
CTAGCTACTACGAAATGGCGGATGGTGTACAGACTGTACTACAGTCCACCAACCCCTCTCTATCCAGATACTCGACGCCATTTCTACAGTCTCGAAGGAT
GGGTAACCAGCCGTCGACCAAGACGCCGCGGCGC