Description :
From Genome Similarity Track
Location :
contig_120:33704- 37554
Transcript NameFunction/comments
g13929.t1hypothetical protein

Sequence
3850 bases(100 bases per row)
CGTGGACAAGGGAGGTGGCCCACCTCCAGTAAATTACTGGTTGTAATTCAGGTGGAAGGGGCACCATGGATTGGTCAAAATTATATTGTCTGGTGCTGGT
CTCAGGGCTATAGTGCAGGTCGCCATATTGCGGTGTTGTCACCCCAATATCGGGTGGCTATTAGGTATCGGTCGGTGCCAGCTGGTTTTCAAGGGTGCGG
GTGGTACACTTTTGGTGTTTTGTGGACAAAGTTTGGTGTAAACAGTACTCCCTCCATGTACAACTCGTTCGGGACGAATTGCTGCACGTAGGAGGAGGAT
GCGCCGGACAGCCAGCGCTCCGTCTCCGTTGACGGGTGGTGGGCAGGGTTTGGTAGTAGACCGCAGAGTAGTAGCGATAGTAGTGATATTATCACTACTA
ATAGTACTACTACTACTATAGCAGTCGTGTTTGGGCCACTAGTAGTGCTAGTTGACTAGTAGCGGAAAATAAGGCCACTAGTAGTGCTAATAGCACTACT
AGTATTTTCAAACTTCAAGTTGCCCAAGATCTTGAAAGGACATGGCTCTCCGCCCTCTCCCTCCTTCGCGCTTCTTTTGGGGTCGCTTATTTCTCGATTC
CCCACCCTGTAACACACACAATGAGGTGCGCGAAGCTTGACTGCTGTTGGGAAGACTTGTCGGAGACATCTCCTTGCAGCGTGTGCGGGCGTATGGTGCA
CCACTTGTGCAGCAATGAACTCTGCACAAAAGCAGAGCTATCTAAAAGGTGGTAATGCTGTTCGTGACCCCATCTTGTCTCTGTTGTTTGTACTAATAAG
CTCTACCTGCAGATTCTGCAGTAGTGCCTGTGTCGCCAAGTTCTTCAGCAGTGACAGCGACTCCCAGGAGCTGACACCAAGCAGCACCTCTGGCATATCA
CAGTCGAGTACAGCCACGGTGATAGATCTCGCACAACGCGGGGAAAAGCAGGAGCAGGAGCAAGAAGCCACTGACAGGATCCCGGATCACATCGCCCACG
CCCCCCCAATGAATTCGACCGACCCGATTTGGGACTTGATTCATCAACTCGACGAGGCATTCACGTACAGGGGCAAGAAGTTCACACACATTTGTCTGCT
GTGCACGGAGTCGAAGACCTGGAAAGACTCTCTTTGTCGAGCCAGCAACTCTACAAACGCGAAGACGCACCTGGTGGCCAGTCACAAAGATCACGAGATG
GCTATCCAAGAGCAGCAACGTAGACTAAAACGGGCCGATCATTACATGGTGCAGGTAAACACTAGAAAGAATGTGAAGCGCCTGGCCTCGAGTGTACGAA
ATTCACAGGAAGAACAGCCTATAAAGCGTCAAAAAACCTGGTGGAAGGCTTCAGTAATCCAAGAGCAGATCTCAGGCCACATCGCGCGGTGGCTGATCCG
TGATGGTGCGTGTTTCGGTTGCTTCATTCCTACAAAGTCTTACTCAATTTCTTTACTTTGCCAGGATTGCCGCACAACATCGTGACGACTCCAGCCTTTC
GCGATTTCCTCGTCGGGGTAACTGGGGACCCGAACGTCACCGTACCAGCCGCCAAGACGTACAACGAGATACTTGACAATCACTACGACAAGTTCGCGAA
CGACACCTCTGAGTTGTTTGTTGAGGAGTTCAAAGAGCTGGATGAAACTCCATTCATGACAGTGGAGCACGACTTGTGGACAAATAGCTGTAAGAATAGC
ATTGTTGGCGCTTCCTGCAGCTTTATCGACCATGAATGGCATCCTCGGCGACTCGCCCTTCTCGCGGAGGTAAAAAACGACGGACACAGTTCTGAAGAGG
TAGCAGATTTGTTAGACGAGCAATTGAAGGCCCGCTATGGTTTGGATGTTCGCAAAATGGCCAGCTTCACAATTTCGGACACGGCGGCAGCAGCACGAAA
GGTCTCAAGGCAGTTCGACTCAACTTTGCAGACCGATTGCGCGATGCACGCACTTAACCTCTGCATCAGCTACGGTATTGGTCTGAAGGAAAACGTGCGC
AACGAGTATATGAAAGACGAAAGGACAAAGCTCTTCGTCAAGAAGCGCGTAGTCGTGACCCAGGGTGGGGCATTCCCGGAGGGAGGTGCAGTTATTCGAA
AGCTGCGCAATCTCAACAACTTCTTCGCGTCGATTAAATCACCGGAGCGTATTGCTCGTCTCCGTGACGTCCAAAAATTTCACAAGCTGCCTCAGTTAGC
AGCTCTGATTGACATCGACGTCCGAGTTGCTTCAACAATCAAGTTATTCCGGCGCTCAATTATTAACTATCCTGCATTCCAGGCGTTCTTTCAGAACGCG
AACGTACCAAAGAGCCAGAAGAACGTCTTTACCTGTATTACATGTGCTGAGTGGGAGTTAGTGGTTCAAATGGAGGCAGTGATGCAACGTATAGCGGAAC
TAGCTCTAGTGGAGTCTCAATCGGCAACCATGCTGTCATCTACTATGTACGTGCTGCTGCGCGTGGCCTCTGCCCGTATGAATTCGTTCAAGTTCTCTTC
CTACTGTTTAAACGGCGCTCGCGACACCGATACCAATGAGACGAACTTCCCGAGAGCTCCAGTGACGTTGCCCGATTTATCACAGTTAACCCAACGCTGT
ATTAAGCGCACGCTACATCAGATTGCCGAGCGACTACCACTGCCGTCTGTGCCGATGGGCATGGCTTTGCTTCTTGACCCACGGACAAAGACGGCTGCCA
AAAACTATCTACGCATTCCGGATACCTCGGAAACAGCTACCGAATATATTTTGGAGGAGACGAAGGCACTTTTGCGCATTGAGCACCGCGTGTTCTATAA
AGGGCTGCATGCAAACGCTGATCAAGGAGAAGGTCACGTAACTTCTGCCTCGAGTTCACCACGGGGAGAGTGCAACAGTAGTTCCGACGCCGAGGCCGAC
TTAGTGTATGGGGAGGAGGTCTCCCAGCCGGCCGAGGAGAGCACTGCTGACGCAACCCTGAACGCGAAGGCTGATGCACTATTGGGCGAATGGCTCAGTC
TTCGAGTGGAGTGGGCTGAGGTGGTGAAAAAACAGTATCCAAGCAAGGACGAGTTCGATAAGGTGCTAGCCAGGCTGAGCGTGCGCGACAGAAAGAGAAA
CGTTCGGGTGTGGAACGTAGAGCAGCTATGTGGACATGTTGACGTGTGCCGTTGGTTTGCAGAGGTCGGCGAGGAAATGTATCCCTCGATTGCGAAACTT
GCACGCGTCTGGCTGGGACGAGGTTGCTCGACAGCGTTTCAAGAACGCGTGTTCTCAACCGGCTCATTTGTGATGAGCTCTTTGCGCACACGGACGGACA
ATGAGCGAGCTCAGCGACAGCTGATACTGCGTCATAATCGGCGTGAGCTAAGGCGCATGGAGGAAAGCAAGCGTCAGATATGGTGACGCAGATTTTGCCC
AAATAGTAGTGCTATATCACTACTATAGTATTATTACTACTCGCGAAAATGCTCAACTAGTAGCTAGTAATAGTAGACCTGATTCTCAAGACTCGAATAG
TAGTAGTAGTATCACTACTAGCCGAAATTCCCACTACTACCAAACCCTGGTGGTGGGAGGCCCGTATCACCGCTGCCGCGCATCCTTCAGTGATATTAGC
CTGCGAGGCGGCAAGCCCATCGCCGCCGCTGCACATTGCGGACGCTGAAACCAGCACTGCTCCAGCAAACAGCTTGAGGGTAAGGGCGTCTTCAACATGC
CTCGGCGCCGTTTAGCAGCTCGCCGCTGGATTTGTCCAGCGACGATGCCGTGGTCTGTCTGCACGCAGCTCCATATCGGTACATGTACATGTATTGTACT
GGCCAAAATAGTTGATACCAGGAATTGTAACACGAGCACATTTGCTGTCA