Description :
From Genome Similarity Track
Location :
Scaffold_630:337- 2900
Sequence
2563 bases(100 bases per row)
CACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAA
CCCTAAACCCTAAACCCTAAACCCTAAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTACCA
GCGGTTTAGCGGTTTAGCAAACCCTAGAAGTACCGTATTTTCTCCATAATATAATACCTGGTGAATCCGATCGATCAATTTCAGCAGGGTATGTGTTTTA
ATATTCAATTTTTCACGCCCAAAAACCTTGTAAAAATGATGCCCTGTCAAATCCGTTCATCATTTTTGACAGGATATCAAGTTTCATAAAACTGTAAAGT
AGCATACCTGTCAAATCCGATCAACAGTTTTGCCGGGTTTATTCGTTTCAATAGTTTTATTTTAGTCATTTTCTACCCTTTCATAATTGATATCACCGTG
GTAACTGATATCAGATATATCAGGATATCAGTATACACAGGTGCCCAGGCACTTAGTAATTTGACAGTGATGCAGACCGAAATTCGCAACTTTGAAACCG
GCTTTGTATACTAAATCGACTACGCTGAGTTCGAATTCGTAAAAAAATCGAACTTTTTGAGGCTCAGTTTCGAGATAACACGTTTTTTGCGTTTAATACA
AACTTCCAGTCAACTTTTGAGGATGAAATTTTGGCTGCAACTCTAACTCACGTGTTTACATATGTGTGCAAATTTTCAGAAGATTCCTGAGGCTAGTTTT
TCCAGGGACCCCTCTACTAACGGTTCTCGACAGTACCGTATCTTCTCCATAATATAATACCTGTCGAATCCGATCAATCGGTTTCACAAGGGTATTTGTT
TTAATATTCATTTTGTCATGTCCAAAAACCTTGTAAATATGATGCCCTGTCAAATCCGTTCATCATTTTTGACGGGATATCAACTTTCCTAAACCTGTAA
ATTAGCATACCTGTCAAATCAGATCAATCAGTTTCACCAGGGTATTCGTTTTAATTTTCATTTTTTCATGGCAAAAAAAAACTTTTAAAAATGATGCCCT
GTCAAATCTGCTCATCGTTTTTGACAGGATATCAAGTTTTATAAACCTGTAAATTAGCATACCTGTCAAATCAGATCAACAGTTTTGCCGGGTTTATTCG
TTTCAATAGGTTTATTTTGGTCCATTTTGACCCTTTCATAATTGATATGATCGTGGTAACTGATATCAGCTATATCAGGATATCAATGTCCACAGGTGCA
CAGCCACTTACTAATTTGCCAGGACAAACGTTCATCCGGGCGGTAATATGCAAGATTCGATCTAAAGATGCTCTTTAATTGTAGGTCAGCCTCCACTCCA
TACTTTCGCTAATTTGAACCAATCACAACACTGCAGCCTCCACTGGATTCCGTGTAGCCTCCACCGGATTCCATGTAAAACGTGCTGTTTAAATGTCAGT
TATGCCATATAACTGTCATTTAGCCTCCACAGCCTCCACCGGATTCCAGTGCAGTGCACGTATTCTGTATACAGTATTCCTCCTTCATATACATTTGCAC
CTATTCCCCCCAATCTAACATTCATAATTGTTTCTCTCTTTTTTTATTCACACCAACCTAACTAATTTATCAACACTAAAATCTTTCACTAACAATATCC
TCATTCTAATCCTACATTTCACCTACTTCTACACAAACTGTTTCTTTACGTACCTACTTACCCACACACTTTCCCCACTCTCATACTATTACTCTTTTAC
CTACCTCTCCGCAAATTACTCTTTTTCTTACCATCCTCATCTACCCACAACGCTTTTACCTTCTTCCTCACACACTCTCGCCATTCCCATACTACTATTC
CTTTTACTTTACCACAATCTACTCTCTTATTTACCCCTCAGTAATGCACCCTCAACTATGTCTACTCTATCTTCTCACATACCCCCATTAACTGTTTGCC
CTGCATCTACACACATACTGCTCATGTATCCCCCCTCAACGTTTCCCCTTAACCTTCGTACACACTCTCCTTATGTATCCACCCTAAAACTCTCCATTTC
CACTATCACTTTTCATCCTCTACTTTCGGACACACACTCCTCATTCATTTTCCTTAAATGACGTCCACTTCATCTCAACACATACTACTCATACTGTTTT
ACTTTCAACTCTATCCTTCATCTCCACACACACACACACTCCATTCATTCATCCATCCATCCATCGAACCCCATACTACTCATACGTATCCACCCATAAC
CTCTTTTTTTCTCCACACACGCATATGCGGCGTTCGTCTACCTCAACCCTCTCCCCTCCACCTTCACACGAACTCCTCATTCAACTACATCAACTACCTC
CCCTCTTCAACACATACTGTTCATACTTGTCCACTCTCAATTCTTTATCCCCGACCTTTACGGATAAACTCCTCATTTGTCCACCCTCAACTATACCCCA
CCCCATCCATCTCAACACGTACTACTTATACGAACCCACTCTCCACACGCACACACTCCTCAT