Description :
From Genome Similarity Track
Location :
Scaffold_935:337- 15850
Transcript NameFunction/comments
Phypl_g11720conserved hypothetical protein
Phypl_g11721conserved hypothetical protein
Phypl_g11722hypothetical protein PHYSODRAFT_532795
Phypl_g11723hypothetical protein PHYSODRAFT_362533
Phypl_g11724hypothetical protein PHYSODRAFT_532525
Phypl_g11725hypothetical protein PHYSODRAFT_247554

Sequence
15513 bases(100 bases per row)
GACCCTCGAAGTGATCATGTTTCTAAAGCTGAGTGACGCTTGCAGAcaatgtattgcaatacctAGGGCCTAGATTGTTAAGATTGCAACGAGGTGAGTG
GGCTGGTAGTGCCAGGCACAAGTAGAGAAATTGTTAAAGAACGAGAACACCTTTTTTAAAGAAATACGAAAATAAGCGAGGATCGGAAAtcgtggtgcag
caactTGTAGCTACAACGCAGAAAAGGTGTGATTTCCTAAGGTCGAATCAAACTGAACACGGTACACATGCTCAGAAGCTGACATCCCAAATTGTCGCCA
CACACCGGCAAGCTCGGCTGCCGTCCAAACGGCGCGATAAAGACAATTTCAGCTGCAAGAACATTCACTCCAAATACGTCGACATAAATTGTACTCGTCC
CCCCActaccaccaccatcacACGGAACAAGACCGACATGCGCTGTGCGCACGCCAATGCGATGCTCTGGATACTGCCGTGACCAAGCAGCCGcgcgcga
cgtccacgcAAGCTCTGCCGAACCTCCTGCCATCCAAAACGTTAGCTCTCGTTTTTaatgcgacgacgacgaacttgTTCAATAAGTCAACGCCCATCAA
CCATAGTGAGGAAAATCCTGGAAACTACCTCCACAGGGCTGTCAGATATGCGATGTTATTAACTTGTAAAGAGCTACCGCAGCCTCTACATCGCTAATTT
AATAACCTTCGCAAACCTTATAATCCTGTGAATAAAGTACAAAAGCGTAGATTTATAAGACCTCACCACTTATAATTTGTATCGAACCAGTACCTACCAT
TAATGTGGTCTACACAGCTTGAATTAATCCCAGTAGGGCTGTCCGTATAACGTACCCGTTGCACTACCAGTATAATTGATTGTTCTAGTGCCAAGGTCTA
CAACCAATATACAATCTATATTTCCACGGCCCTGCGTACGAACACCTTTACTAACCACCGTAGACGCGACGAGCCTCAGACCACCAAGGAGGATGCGACC
CCGTAAATTGGCGGGCTTTGCAGGGAACTGTCTCGAGGGTAGGATTGTCTACTAATAGGAGGCAGCACCCTTCACATCCGCTGTGGTGGAAGATCCCAAA
CTTGGGCCAAAGCGCGTTGTTGAGTCCTGTCTGATGCAACGCATGAACGTGCTGTCGTTCGGTCCTTAATTTTGCTTGCACATCTCCCCGCTGGCACGTC
TCAGTTGTGTTCGTACCGAAACTCCGACGACGCACCGGTAAGGAGCGGAAGCGGTAATCAATTTCTTGTCAAAAAGGTTTCCCGTCGAGTTGCCTGCAAG
TTGGTGGGCCATCGATCAGAAAACGGTGTGGATGTCCGCGGGGGCATTTAGTTTGGTACTGCAATGGTGTAGCGCTCAGCGAAGGTTGAATACGTAGGCG
CTACGACAAGTACATCCGCGTACGACAGCGCTCTGTGGTCGTCCTCACCGCATGAGACGGGCAATATCATATGTACATATAAGCTTAGCAACCGGTTGTT
GTTAGCACATCTGCAATGCCAATCCTGAAGTTTGCGTCTTTTTGAGACAGACTCCCGTATAGGCGGCAAGTAATCGCTGCTAGGACTCTGTCGACCAGCC
GGCTGACCTTCGCTGTGACGTGAAGGCCTCGGCTTGGCATGAACCTGCACCGCTGTTTCCCATGCTTACTGCTGTGTTTGCTAGTTGTACAACCGAGCGA
AGATCATCTGAGACCACCTCATCCAACGGAACTATCTTGCAGGTTTGGTTCTGCACCGGAATCTCCGACGACCTCGAAGCTCCTAGCTATATGGAGAGGA
CCACAAACCACGTTCGCAGGCTGTTGATCATAGACACAAATCTGTTTTTCCAGGTAGCtttgttgtacatgtacacgtaTGCCAGGTACAAATTCTGTAC
ATTTTTAGCGTAGCAAGGTCGTTTTGCGAATAGCTAGCGCTTCGCAGAAGCAAACTTTTGTGACCGATACGGtattgcagcagcatgcacgcACATTCAA
ATACCAAGTTCATTCTTCGTTTTGCGGCCGTTTCCGCAGCCCTTTGGTGTGGATCAAGATGCTAAAGTGGATCCAAGTCATCGCTCTGCTGAGTGCGAGC
TTCGTGCGTTCTACTGCACAGAGTTATAACTTCAGATCTACACTGACTGCAACCGCCCCCTTCTCCGACAGTTCAAGCCACGGCGGGTCTTCGGATAGTG
ACGATGAAGGGTCTGCTGATAACCACCACGACGATGATACcctcgacagcgacggcgagtcgTTAGACAGTGACGACCATGGATCGGGCATGGGAACCGG
ACCAACCAGTGGGGTTATCCTATCCACAACTGAGTCGATACATACAAACTGAGTGGGTCCTTCCCTAGGCGGCCCCGACACAGCATGCTACCGCGAAGCT
CATATCGCGAAGACGTGTCCGCTTGAATTCGACAACCACTTCGACATTTGCTGGGCCGAGTGCCCACTTTCGTATCCCGTCAAGTGTGGAATGGAGTGCA
TCCGCCAAAATGACGACTGTGGGCTTGAAGTCGTGTCCAAGGTTTCGAACATCGCACTGTCGGTCTTCTCTCTCGCCACGTTCGGTCTGTATGGCGAGTT
CAAGCTGATGGCGAAAGGTGTGAGGACAGCGTACAAGTGCGGCAAAGAGACGATGAACTTGGTGAGGCAAATGAGCAGGTTTGTCCGCATCGTCAAGGTT
ACCCACCCACACAGTACGGAAAAGTATCTGGAGACAGTTCTCTACCAAACCGAcaacgtcgtcttcgacttgccTATCACAATATGTACGTGTCTGGGCT
TGCACGTTTCAGAGACCATCAAGATAACCGCCAGAATCACCAACACGGTTGAGCTCTTCGTGAAGGAGATTGTGGCCACCAACGACATGATCGTTACCAG
CTGGGTCGCATTCTAAGCGTTCATGAAGCGAatcacgctggacgagtccATGGAGGAGCTAGATGAGTCTGACATTTCTTCGCTTCAGTCCGCGTTGACG
TCGAATTCTACTTGCGGGTACAACATGAAGCATCTGCTGGATCGCACCTGGATGACCGTAGCGAACCTTCGTAAGGAGAACCCGGAGATCTCGGAGGCTG
ACATTCGCGTGGAAATGAGCAAGTCGAACCTCGTCCTCTACGAGATCCCCACCGTGaccaacaactgcatggGAGAGCTGATCGACGAGTCGGACGAAAA
GATGGGATCCACAACTCGTGACACGCTCCGTAAGAGTTTCGGAGGCATCATGGACGACTTGATCCGCTCCGGTACCAGTGACAACGGAACGCTTCTTACT
GCTGAAACATACGCCTACAAGATCGCCGACAAGGCGCTTACTTTCTATGTTGTTTGGGATTTAACCAACATCGCCAGTGTTGTCTCTGAGTTCTTCCAGA
CGATTTGTGGCCCTACGAAATTCACgggcgagatcgacgacggaAGCGCGACGGACGCATTAGGTCTGGAGACggtcgacgacgccttcaGCGGCAGCAC
TGGCAACTGAACCAGGACCGGCGACGGCACCGTAGCCATCACATTCAAAAGTGCCGATATAGAGGACGTGACGGTCAACATCAAGTCCGGTGGCAACAAG
TTCGCCAAGGTGGCTGTTCCGGCTGGCGAGACCGTCACATGGACCTCGAACGTGACGGCTCTGggcggcaagacgctgtATCTTGATCGCTGGCGCCCGT
GATTCCTGGGTCTCCCTGGCACAGGAGGGGGTTCACTATTGCTCTGGGTGCCTCGATCCACGCAGGGTGGCAGTCTGCAGCTGACCGCGACGCTCAACGT
GAGTTGATTCTTGGGCGGAAACTCAATGGCCGAAGTCTGCTTTGATACGTGAGATACAAAGCATACAAACGGCAACGGTATCGTTCGCGCGgttcacttc
aacgtgccaGTTACCATCATTCTTTCCGACAAGCTCCATATAGTTGACACCCCGTCTTTCCAGCTGATCCCGAGCCAATCCTCCAGTATCAGATTTGGCC
AGTCCACCCAACGAACTTCTGTTTCATTTGATTTCAGTATGGTTTCACGAACCAGAGCGACACGAGGGTAGTGCAGACCATCGCTCCTCATGCCATCGGG
AGTCTCACGCTTCTCCTTTCTTTCCCTTCAAACAAGGATTCGCTCAGcttgaagaaggaggagatcgtaccatgcgcgcgctgctgctgagtctAGCGGC
CGCGTCGGCCGTCGCGAGCGCCGAGCGCGGCATGCGCCACGGCATACGCCACCCCGAGGACGCGGAGATGCCGTgccaccacgagcaggagcaggagggc
gaggacgtcGCTGCGGGCCTCATGGCCGCGCTGAACGAGCAGTTCCAGCgctcgagcgagctgctgcagagcttcttccgccTGGGAGAGACgcaggacg
acgtcgtgcgcGTCGCCatcatggaggaggaggaggatccggcgctggagcggatGCGCGCGTGCTTGAAGGCACTGGAGAAGATccacgagcaggacga
gctgcaggccgagacggagacgctgacgAGGTTCTTCCGCTCGGCATTCGACATGGTGTCGCTGCAAGTCTGGGGCGAGACGTCGtgcgaggagctggag
cggccggagctggtggagcaggtgcGCAGAAAACAATTATTGTCGGGAGGAGTTTCCAATTATTGGGGAAGGGGGAGGGTACTGATTTATGGGTATTGTC
GTAGTGCAACCTCGTGGTCAAGTCGGAGGATGTGGTGCGGAAGTTCCTGCTTCGGGGcaagacggacgacgaggtgtgCGATATCATGTCCACCGTCTCG
GACCTGGAGGGAGCAGACAACTTGTCGTGCAAGTTGTGCCAGAGATTCGTGCAGATGATCGACCAGGCGCTGGCCCAGGAAGCGCAACAAGTGCAGCAAG
TCCGAGCCATCATCGGAGACCTGTGCGACGCCATGTCGTCCGACTCCATGTGCCACACGTTCCTCAAGAACtacgacgccatcgtggactGGCTGAAGCA
CGGCACCGAGCCGCTGGTGGTCTGTGCCCGGATTGCCATGTGCTCGTCggagagcggcagcggcagcgagatCTCGGATCTTCCGTGGACGCCTGAAGAG
CCCAATACGGTCGAAGATGGAGCTCTGGTCACGGCTGACTTTGTTGAGAACGACCAGTCGTGCACCTTCTGCAGTCACGTGGCCGGTGTCATCTACCAAG
TCAACGAACTGTCCCCCGAACAGCTCCCGATGCTGAAGTCGGTCTTGGGAACAGTGTGCGAGATGGCCTCGCCGGAATCCAAGTGCCAGAAGGTGGAGGC
CAACTTTGACCGCATTGTGGAGTTAGTGCAGCAAGGCCAGCACCCACGTGAGGTCTGCGCTAATGCCGATTTCTGCCCCAAGAAGCCTATGCGTGACATG
CCACCGTCGGATCGGATGCGTGGTGGTGACAAGACGTGTGTGTACTGTGATGCAGCCACTACTGTTGTGGAGGTTATACTGCAAGAGGCCCCCGAACAGA
TTGACCAGATTCGCGAGTACGCTGACATGATTTGTGGCATGCTGGGAGACGATAGCCCGTGCCACCAGTATGCCAACCAGTTGAACACTGTAGTTGACTC
CTTGAAGAAGGGAGTACACCCTCGTGACATTTGCAAGACACTGAAGTACTGCTCAGCTGAACGCATGGACAATCTTCCTGAATTGGACGAGAGCCCTCTT
GTCGGTATGATGAGAAATGGTCCTGGTGGAATCCATCACCATGTTGGAATGATGGGTCCTGGAGGCCACCACGGCCATGGACCTCGTGGCGAgatggcga
tgatgcagGATAGTGAATACCCACCGCACCCTCCTCACCCGCACCCCCATGGCAGTTGTTTCGTCTGCTCGCGTGTGGCCATGGTGATCCACCACGTTAA
CCACACGTCACCAGAAAAGCTGCCGATCGTGAAGACCATTTTGTCGAACGTGTGTCAACTGGTGCCTTCGAAATGCAAGTGCGATGTTGTAGACAAGAAC
TTCGACAAAATTGTtgagatggagaaggaaaGCAAGCACCCTCACGAGATCTGCAAGTCCCTCGGAGTTTGCAACAAGACGCGAGGCTGGGAGGAAGGTG
CGCCTTCCATTACCGACGAAATGAAGGGCGTGGTTGTGGCTTCACAGTGGCCTCCTGGAAACGCGACCCAATGCACGTATTGCCAATTCGCTACCACCGT
TGCCAAGATCGCACTTCAGCAATACGGCACCGACATTCGTCAAATTCGGGCGTACGCGGACATGATCTGTGATATGCTGGGTTCAGATAGCCCGTGTCAC
GTTTACGTGAAGGATCTTGACTTCGTGATTGATTCGATCACCAAGGGTATGAGTGCCAAGGCAATTTGCTTGGAGCTTAAGTTTTGTACAGCAATGGAAG
GGCAGCTAGCTATAGCTGATGGGGAAGAAAATGCTGTGGCCGTAAGCTCGGGTAAGCACCGTCACCACGACCACGGGTGCTCTTTCTGCATCCACGTTGG
CATTGTTGTTCACCACGTCAACAAGACAGAGCCGGAGAAGTTCCCGATTTTAAAGACTATATTGACGAACGTGTGCAAGCTGGCAACGCCTGACTGCAAG
TGCGACGAAGTGGACAAGAACTTTGACAAGATTGTGGAGTTGGAGAAGGAGGGAAAGCGCCCGCACGAAATCTGCAAGACTATCGGACTGTGCAAGAAAA
AAGTGGACGTGATAGCAGACGGATATCCTTTCACTGATGCAGTGTCGGCCTTAGTTGCCGACACTCGCCCTGCTGCTGAGGGTGACACGAAGACGTGCTT
CTTCTGTGACTATGTGACCAGCCTTGTGCAGGCGGCCTATGAGCAAGACTCGACCAAGATCCTACAGATCAAGCAATTGGCGGATACTGCTTGTGCACTT
CTAGGTGAAGAGTGCGGGTGCCACGAGTACGTTGTAAAGCTGGACTTTGTCCTGGATTCGCTGAAGAACGGAACGCACCCGCACGCTATCTGCCAATCGA
TGAAATACTGCGCGGCGAACAACACGTTGGCTGCACTTGCGCCGCGGTCCTCGAACAGCGATTTGTCAGCCTATGACCCGATTCTGGTGCAATTGGTGAA
GGAATCGATGGAGGTGTCTGTTGACGggtgcttcttctgcacgCAAGTGGCATCCGTCATCGAGGTTGCGGTGGCTGAAGACCCGAGTAAGATTACGCAG
ATTCGACAGATTGCCGACGTCGTCTGTGGAATGCTCCCGAGCGACAACCAGGTATTGTGATTCGCTGAGCTGGAACTTCaaactgctgctgtagtTATGC
TGATATTGCTCTGTGTGATTGTGCAGTGTCACTCGTTCGTGAAGCAGTTCGACACTGTGGTTGATTCTCTGCAGAAGGGCGAGCAGCCGAAGGCTATTTG
CCATGATCTGAAGTACTGTACGGTGGACACCAACCCTGCTATGGCCAAGCTTGCTGTGCCCGATATGATCGCTGTTCAGAACAGTGACAAGGGAAGCAAC
ACGTGCGCCTACTGCAGTGGTGTTGTCACTGTACTCAAGTACGCCCTCGCTCAAAAGCCGGAGCAAGTTAAGGAAATgcgtgaagctgccggcATCGTGT
GCCAACTGCTTCCAGCCGATGATACGGTACGTGCGGTGCCCTCGATCTCCCTCCGATGACGTAAATCTGACAACTCTTGTATTATATTTGCGTGTTTGAT
AGTGTCACGACGATCTCAAGATGTTTGATGAGGCAGTGACCGATCTGCAAGCTGGAAAGGAGCCCCAAGAAATTTGCCAAGCGCTGAAGTTCTGCACGGC
AACCGAAACTCCCAACGACCTGATGTCGGGTCTGTTTGATTTCACTGGTGCAGATTTCCTGCCTTCGAGGTGCACGACTTGCCAGCagaacacgctgctg
ctcgcatCGTTGATAACGCGGCCGGACAGCTTGGCCACGTTTGAGCGCGAGATCAACTCTATTTGCCGATTGATCCCGGAGTCAAGCGAGGTAAGAATGA
ATATGTTCGCGTTCGTTTCATGGTGATGTGCTGTCTAACGCCTTATCTTGAATGAAATAGTGCGAGCTGCTCATGAAGCACCAAGACGCGATCATTGATt
cgctgaagaagaacgaagCCGTAGACACAATCTGCACGCGTATTGCGGAGTGTGGACCTGCGGCcgtggaggaggtgcaggaggagaagtCAATGTCTGT
GGGCTGCTTGTTCTGCGAGTACACTGCCGACCTCTTGGAGTTCGCCAAGGATGACGAGAAGGCCTTGCGTGAAGCTAAGGTAATGCTGGAAACTATGTGC
ACGGTGCTGCctccacgcgcgcgctgcgaTGTGCTTTCCTCTAAGTTTGATGAGCTGGTGTCGCTCATGCGCGAGGGAAGGAGCTCTAGTGAAGCGTGTC
ACTCCATTGCCTTGTGCGACATGGATTTCGTCTACTCGGGCAGCCGTGAGGACGACCCTATCGTGCAAGGTTTCAAGAAAGGCCGTCAGAGAATGGGCAA
CTTGATGGAGATCCAGTAATTGGAGAGCTCGCGCGGTGTGGTGCGCTTTCTTTTGTACGTTGGTTGACGACTACTCGGTGACGTCGTTCTGCTCATTTTC
TTCTCTACCCCACTGTTAACAACTGCAAAGGAGTAATGCCTGAATGAATATCATTTTCAAGCGAGGAAACTATGACTGATCTCGTCGAGGAACTTTTCTG
TCGGTGTCCACACGAAGGTAGGCAGCAGCTTAGCGAGACGTGGCAGTGCTGATCTTCGTGTTGAGTGGTGAAGGGTACCCCAAGTCGACTTGAACCCGCA
TCGTTGGTACAATTTCTCGCGTTACCGAGGCAACGGCCTCCGGATCGTGCTTTGCATTCGCAGCGAGATACTTGTGCGCAAGCGCCACGCGGGAGAGTGC
CTCGACACCACCTGTTCATATTGTTAGTGAAGAAATAGCTGGCCATCTCTACGCTTTGTTGACGTACCGACGTTGGCGAGAGTAATGTGCTCCTTAGTAT
CGACAGCCAGCATCTGGAACACGATCTCAGCCAAGTCGAAAACGTAGAGGTACGAGCGGAACTCGTCACTCCACAACTTGAGAGGCGCGTTAGCATTCTC
GGGTTGGAATAATTGGCGATGCAGCCATTGCATGAACTTTGGTGCACTTCTGTCTGGAAAAAACGGAGCTGCCGGCCCAACGACGTTCGCAATGCGAAGC
ACCAGCACTTGTACGTTTGTCGAGCTGTCGCGCTCTTGCAGGAAATGGCCAAAGCGCAGCTTGCCGGCACCGTATACCGACAACTCCGACGATAAAACtg
catcatcttcatcataGCTCGCACCCCACGGCTGCGCTCCTTCATAGACAAAGTCCGTCGACAAGTGCACGAATCGAACTCCCCACTGaagctcctccag
caaagCCACCAAACCCCGAGGCTACCGACCAAAACGTCCACAAAGGCAATATCAGACTAAACACACGACGCACTACAACCACTGCTGGTCTAGTCACCTC
ATTGACCGCGCGTGCCTCCTCTGGGTCCTTctggcaagctgcaggtgacgaAATCGCTGCGCAACACCCAAAGATCAGCAATTGTTGGCAGACTCTGCGT
CATTCTTTCTCCTTCAATTCCAGTACCAACGTTTACCTGTGCAATTGATCACCACCGTCGGATGGAAGTCCTTGATGCAATTTTCTAGCGCTTCTTGGTC
CAGTGCGTCCACTTGCCAGTACACCCGCACAGTTCGCGTTGCGGACTCTGTCGCCACGAAACCCGTTGGGAGGGGGGCGAACGGTTTGCTGCGCATAGTG
CACACCACTGCCTCAATTTCCACCGGTGCATCTTCAGTGGCCGCTCGAAGCGTCTCAccctgctgcagacgctgcagcacgaactgCGCCACGTAGCTCG
TCccgcccagcaccagcacgtgtGCCATGCTTGTCAATCTGATTAAGCGCGTGGACAAATCTGAGTCGAGATCAGACCATTTTACGACACAAATACGCCG
AAGGATGGCGGAGATGCGGGGCTTCACGGAGATGGCGCACCAAGTGGGCGGCCACACCACGTCCAAGACGAGTACTGGCGTCTGCAGTAGAAGCATTGGC
ATTGCCACTCAGAACCGGTCTAACGCATGCAAGCATTGTGTGGTTTCCGCTGCATTCGGCAGGTCTGAAGGCCCGCAACGGGCGCATCTTGAAGCCCTTC
CAGAGCAAACGGCGGGgagagcgcgagcgcgacttCTATGAGCGCGTGTTCGTGTCCGAGAAGGATTCGCCCGAGTTTGCAGCACTCAGGGGGTTTCTGC
CGGGCTATCACGGCACGGTGGAGGTCCCTGACGTGGGGGACGGACAAGAGGCCACTGGACTGCACCCCGGACGTACGAGAAGTAGTTGTAACGGAGACCC
AGGGCAGCTGATGATGGTAACGGGGACTGTTTATCTGTTGCTGTGTGCAGAGTacttggcgctggaggactTGACGTGGGGGAGGCAGTGGCCCTGCATC
ATGGACGTCAAGATGGGCACCAGATCctacgaggacgacgcgacggccgagaagatcgccTACGAGAAGTCCAAGTTCCCGTTGCAGGAGACGGTGGGCT
TCCGTATCCAGGGCATCAAGGTGTTGgactccaagaagaagagctaCGTCGAGTTGGACAAGTACTTTGGCCGCGGCATCACATCCGTGGACCAGCTCAC
CCCCGCCTTCCGTCGCTATTTCCCACCGGAAGACACGCCCAAGACCGTCAAGCTGTTGAAAGCGGTGAGTTTGCTGCAATGTCTCGTGTGTGTGGGCGAC
ACGCTTTGCAGGCACAAATGACGCTATCCTTCTTCTCTCCATTGCGGCTGCACTTTAGTTTTTGCGGCGCCTTGACCGGCTGAAGGCGTGCTtcgatgag
cagcaaggGACGGAGTTCatcgccagctccttcctcttcctgtACAACGGCGAGGAGTCGAccaaggagggcgaggccgTGGCAGAGGCCTTCGGAGCCG
ACATCCGCCTCATCGACTTCGCCCACGCGACGCAGCCCGCTTCTCCCAAGCGCGACGAAGGGCTGCGCACTGGCATCGCCACGTTGATCCAGTGCTTCCA
GACGCTACTCCACGAAGCCCACATCCAGCACTGAGCAGCGCAGTAAGAGATCGCTGCACAAATCGCGCTCACGTCTGCGAGTCATAGAGAACGGCTGTGC
ACGAAAACTCCGTCCAAACTGCACCATGTGCTACAGTATTATTAGTACCCGATGACTCCAGGTCCAAAACCGACAGCAATGGTCTAGTTGAAGCTGTAAA
GTCGATGGAAAAAAACCGTTTCGAAACAAAAAATATATCGAATTGTACAGTCGAGCTACACCGCAACGGCGTCCATTTCCGCTTTCTTCGAGatccccag
cagctccatccgaTGCGCCCGCTGAGCTCGACCCCAGGCAGCCCCAGCCGAGGCGACAACCAGCGCGACGCCGGCGACTACcgctcggagctggagcgct
tGCTGCACGTGTACGAGCCGGGCAACGAGGCGTCGGCCGCGCAGTTGCTGGAGACGTACGCGGGCATGGAGCACGAGCTCATCGAGTGCTACCGCCACTA
CTACGCCGGCAAGGGCAGCTTCCGCGTGGCCCTGGACGACAACCAGGAGGCCGGCTCGCCGCGTGTCTCGTCCCCGGGGCCGCTGCATTTGCCCACGTCG
GCCATCGGCACCTACCtgcaggccaagctgcagtcgagACGGGGCGGTGCGGCCCGCAACGCTAAGCTCGAAGATGTGCGCGgccccaccgccgccgaca
gcCCCAGTAGGAGACGCCCCGCGGCCGTCGCGCCTCGACGACGGGCCATCAGCTTCACTGCCagactgcagcacgacgctggcgcactgagcagcagcag
ctacgaagacgaggacgaagccgAGGTGTTGGCTCGACGAGCGTCCACTCCGACAGAGTTCAGCTGGAGTAGCTCGTAGGGtgtgacccccccccccccc
cccttccaGACCATTATTAGAGCAGTGTAGCTTAGCCGTCTGGACCGGATGAAGTTGTTGTAAGTTACCAGCCCCTGAACCATGACACAAAGTGTGACTG
CGGCCTTTGGCGCGCCCTGCCCCGTCGAGGCACTGCCCCCAACACCGAAAATGTCTGAGCTTGTACAAGCAAGAGAAGGGGGAGGTGATGCTGGCTGCAG
ACTTCTGCACCAGGGAGGCACCAAGAtgttggtggtgccgctgtACATGGGCCCaggcgaggaggacaaggacgacgaccgaCAGACCAAGCAACACCGA
TAACACACGTCAAGGTTCAAAACAAAACGTGTTCACGTGGATAATGCTTTTGTTCGGTCCTTCCTTGAGCTTGGTCAAAACTGGTTGGGAGGAAGGCTAC
GTCCCCAAGCCGACGGCATAAAAAACACTTTGCTGCCGCTTcctcgagcacgaggagctccgatCCATAGCGGGGTTGTTTCTATCTCTATTACAGCAGT
GCAGTCGGCTCAAGGCGTTGCTCGCGCTTGCACTCGGTTCATTCGGCTTCGTCTCATATTGCGCGACGTGCAAGCAAGCAGACTTGTTCGGCGACCGCAC
TTGGCATTGCTGGGCTTATAacatctgcatctgctgctgttgctgctgcaagttgtGCATCTGGTGCTGCGGGTACCCGTTCGCTGAGTAATACATCATg
ttcggctgctgctgggacgTCGACTGTTCGCCGGATGCGGGGGCTTGCGGGGGCTGCTGGCTGTAATATGCTCGCGGGgcctgttgctgctgctgaccgt
aggccgcagcggcggcggccgagtcTGCTGCGCTAAGATGGTGGTGGTACTGCGACGACTGGGCAGGGTACGGCAAGTGGTGgccgggctgctgctgctg
ctccttgttcACATCGAAATAGTCGACTCTTCCATCCGGGTGGTGCTGGGGCATCTCCGGCTTGGCCGCCCAGTGCTGCGTGTACGGGTTCTTTATCTGT
TCTGGGGCGGCGCGCGGAGCGTACGCCTGGCGGTCCATAGCGGTCGCAGGCTTGTACATGCTTCCAGACACGGGAGGCAGAGCACCGTTGTCCACGGGCA
TGTGGTAGCGAGCGGCACCGCCAGCCTGCAGGCTGATGGGCTCATAGGATCGCTGGTCGGCGTGGATCTGAAGGTACTGGCTGGCGTTGGCGGGCGCCTC
GTAGCCCTTGTAGCGCATGTCCATctcaacgcgctgctgctgctgcacgtacgcAGCGCGCTGCGCGTCGACTTGGCCGGCAATGTGCGGGTCACGCAAA
TCCTTGACACCCATCGCGAACGCCGGCGTAGTAATCTGTCGCATGTCCATCATGTGCTGCGGCAGCGAAGCGGCCGACACCCCAGCCGTAGCGAGTTGGT
CCTTGGGGAGCTTGCccttggcggcgttggcgtgGTAGGAGCACTTGCCTTTCTTGCGCGCGGGTTTGTTGCAGCCGGCGTGGtcgcagcgcttgccgcc
gccgtgctcggCGCAGAAACCTCCGCCGCGGTCGTTCTTGGTGCAGTCCGGGTGCTGGCAGAAGCGGCTGCCGCCGTGGCCGGCGCAGAAGCCGCCGCGC
TGGGCTCCCTTGTTGCATCCCTCTTTCTCGCAACGCTGGCCACCGCCGTGGGCGCGGCAGAAGCCGCCACCCTGGCTGCTCTTGGTGCACCCTGGGCTCT
GGCAACGCAGGCCACCGCCGTGGGCCTTGCAGAGACCGTTGGACTGGGACGCCTTGGTGCAGCCAGGCTGCgtgcagcgcttgccgccgccgtggcggaT
GCAGAGGCCCTGGCCCTGactgctgcgctcgcagccgtcgaccatgcagcggcggccgccgccgtgagcTTTGCAGAGGCCCTTGGAGCGCACGCGCTTG
GTGCAGCCTGGCATGGTGCAGAGGCGGTTGGACTTGAGCGCCGGGGCGGCCGCGGTcttggccgcggcggccgtcgTGGGATCATCGGACGCCTGGGTCT
GCTGGATCTTGGCGACGCTGGTGGGggacgcgctggcggatACGGCCTCGGTCTTGGGACGCACGGGCTCCTTGGCCGCGCTGGTCACGGgctcggcgcc
ggcgccgacggcggcCATGGAGTTGTGCACGGCctggtcgtgcagcgcgcgctcctgcGCGTACTGCTGGTAGGAGGCCGGGTCGTAGTTGAAAGCGtgc
gcggcggtggccgaggcgtcgagcgcggcggcgctgggaTCTTGCGGCtgcatggcggcggcgctgctggcggatgTGGACTgggacgccgaggacgcgg
acgtggaggccatAAAACTAACTGCCCCTGCTCCGGCAAAAAAAATACTCGCGGCCTCCTTCGGAGACGGGCACCGCGGGGCGGGGCGAgggcgaagacg
aagactAGCGCGGAGTACCAACGGCCTGGCAGGAATGGTAATAAGCGCAGGACGACCACTCACTCGGCCCTCGCGGTCTGGCTATGCCCAGACGGGAAAG
AAGGGACCGCGCGGGTAGGGGAGCACCTGCGATTCAATGAATCGCGCGTCGGATTGTGTGCCCCACTCCGAAAAAGCTGGCTGTTCTCTTGAGACACGTG
TGAAGCTGATATGGCGGTTGGCGCTGCACATACTGCAGTTCATTTCGCGCCGAAGATAGCTTGGCTAGCGCTGGAGTCGCCGCGCAAAGATAGCATCACC
AGCTCCGCTCGCTGCCGGCTATAAATCAACCACCGCGGGCGGCCGTCCAATCACGGCCGGCGACGCGGGCGCAAAGGTACAACCCCTTCCGCCCAAAGCC
GGTCCAGATCCCTTCGCGTGTCCCAGCCCATCCCCCGACTCTTCTCTGGCGGTCCGTGATGCGTGACAAGAGAGCAGGCACGACGCTCGGGATGAACCAA
TCGCCGCGATTCGCGCGCGATTCAAacggcgcgcgctgctgggtgATTGGCGGGATTCAAACGGGCGATTTAACGGCGTGCCAAAGCCATGCGCTGAAAA
CGAGCCAAACTGGACGTGCTCGGTGGCGATGTGAACTGCTCgccgagaacagcagcgagctccGGCACGATGTGCACTGCGGCAGGCAGCAACGCGCCAG
TGCTTGCAGTGttatacttcgaagtagtttGCCCATGcactgcagccagcagccTGCAGTCTGCGGGCTGCCGGGGTTTACCTGCAGACGCTGTAAATAG
TCCTCTGCGCAGCGTCGGTGACTGCGTGGCTCTTTTCGCCACCAAAACGGCCATAATGCCTGCATGGCCGGTCTCTTCTtggtccagcgccatggccacT
TTGACGTGAAGCGGGCGGCGATTTCAAACGCACCACAGCcgccgagcgccacgccgcgcAGGTCGCGCGTAGCCTTGGCCCAAGGCCCTTGGGGCTCGGC
CTTACACTTCAGAATTGCACGGGTGACCCGCCAATGGCTCTACGAAACCGCGCGATCTAAGAGTTAACACCGTGCACGGACGTGACCGCATTTCATTAGT
GCTGCATTGGGAC