Description :
From Genome Similarity Track
Location :
Scaffold_627:337- 1547
Sequence
1210 bases(100 bases per row)
AGAGCTACCCAGACTGCCCGACATCTACGCTGACGAACCGTGAAGCAGATCGCGTAGACTTTGACGAATGCTTGCTGCCCGAAGACAGCTAGGAGCGCGA
GCTCGATGAAGACGAGAACGAAGCGGAGGAGGTCGCTGGTGAGCGCTCGAGCAAGAAGACTCGATACGGCCGCACGCTACGCGAGTACCTGGGCTACGCC
GAGCCGTCGTGGGTCGACGAGACTGACCTCAAGTATGGAGCGTAGCTGAGAGATTTCAAGCGGGGGAGGACAGATCGCTACCATTTCGAAGCAATGCCGT
CGCATGAGGAGTGAGCGGTGGGAACATCAGTGATGGAGAGGTTATTGCAGAGAAGTCAGCGGAAGAAGAACTTCCAGGAAGGCGGTATGTTTCGGGAGGA
AATGGTACATGTGGAGTGTGGTGGGCCTGAATAGGCCGGAAAACTTAGGCACTACGCTTCGGAAGATTCTGGAGAAAGAAAAAAAGATACGAATGGATTA
GATTGGATTAGATCCTCTCGACGAATGCTGTAAAACTACGGAGCTGCTGCCTGACATACAATGACATGGAACGATCAAGAAGAGGAATGCGTGAGCTTGC
TAGACAGACGAACGATCTCAAGAGCCAGGTGGTCAGCCGGTAATACCAGCCTCGTCTTAGAGAGGGAAATGCAGGAAGAATGGATCCAGCAACAGGTCGA
GGTTACAGTAGCCCCGGAGCATACCGATCAGCACTTGTTGGAAAAACGATTTACACCGGCTCTGGATCGACACTGCTTGCGGTCGGTGTAGAATGCTTCC
AAGTATCGATAGTCGCGACGCTTGGCGATGCTCACCGGGAAGGCGTGCGTGGAGCGCAAATCAGCCCGAAGTTGCTCATCTTCATAAGTCGCGATGAGTG
GCATCATGTGTCCGAACCAACCCCAACAAACGTCAGGGGATTGACCCTAGCAGCGAGGACTTCCCATGGAGTAAACTCGATCAAGTCGCGTACGTTGCTC
TCGTCCACTCGATCATCTCGCCGGCCCGACCATCAGAAATCTCCCAAATTAATTCATCGTTTTGGACTACCAAGCTGTCCCTCTCTTGTCGAACTATCGC
GGGCGTGGTCTCAAGGTCTTGACACGACATCTTCGATTTTTCTACCTGATTATTCCGCTTCTCCAGTCGGGCGATGGAGTCCCGAGCCTCTGAAACACGA
TCCTCTGTGG